Rmu_co7958283.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7958283.1
OG0013424
Physical Location & Seq
Reverse (-)
1 .. 478
478 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7958283.1_g000001.1.cds

Sequence Viewer

Length: 411 bp
atggctctaacaatagccaacagtggcggtaccaacggcggagccagagtcctctacagaagctccaccacacacccgtacgccaacctctcctcccaacgccacgtcctcttccccctctccccaagaagaaccctccacgtggtgtccgccaagcgcttcacctccagaaccgggaggctggacaacaagaacaacaacagtaacaacaagaggagcaacaccacgaccaaggaccaagaacaagaccaacggacggtggagactgaaagcctcgctgccgataacattgatgatggctacttcttgcctaagcttccgggagatgagccggatttctgggaaggtgaacagtgggacggtcttggattctttgtcgagtacttgtgggcttttggttttggctttgcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.39

Weight (kDa)

6.28

Isoelectric Point (pI)

51.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013424)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G73885
fragaria_vesca FvH4_5g12290
malus_domestica MD06G1215200.v1.1 MD14G1226000.v1.1
prunus_persica Prupe.5G220500_v2.0.a1
pyrus_communis pycom06g19180 pycom14g18750
rosa_chinensis RchiOBHm_Chr7g0185261
rosa_laevigata RLG00000004926
rosa_multiflora Rmu_co7958283.1_g000001 Rmu_sc0008496.1_g000017
rosa_roxburghii Rroxscaffold_3G00269100
rosa_rugosa Rorug06G0467400
rosa_samantha Rh7AG075600 Rh7BG071900 Rh7CG073100 Rh7DG072500
rosa_wichuraiana Rw7G006030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 29
AccB1I GGYRCC 1 cut(s) 29
AciI CCGC 3 cut(s) 27, 39, 150
AcvI CACGTG 1 cut(s) 142
AdeI CACNNNGTG 1 cut(s) 145
AfaI GTAC 3 cut(s) 31, 80, 383
AfeI AGCGCT 1 cut(s) 158
AfiI CCNNNNNNNGG 3 cut(s) 142, 174, 256
AjiI CACGTC 1 cut(s) 106
AluBI AGCT 2 cut(s) 63, 316
AluI AGCT 2 cut(s) 63, 316
Alw26I GTCTC 1 cut(s) 257
Aor51HI AGCGCT 1 cut(s) 158
ApeKI GCWGC 1 cut(s) 278
Asp718I GGTACC 1 cut(s) 29
AspLEI GCGC 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 235
AsuC2I CCSGG 2 cut(s) 175, 321
AsuHPI GGTGA 2 cut(s) 154, 359
AvaII GGWCC 1 cut(s) 235
BanI GGYRCC 1 cut(s) 29
BbrPI CACGTG 1 cut(s) 142
BbvI GCAGC 1 cut(s) 265
BccI CCATC 1 cut(s) 290
BceAI ACGGC 1 cut(s) 52
BcnI CCSGG 2 cut(s) 175, 321
BcoDI GTCTC 1 cut(s) 257
BfmI CTRYAG 1 cut(s) 55
BfoI RGCGCY 1 cut(s) 160
BisI GCNGC 1 cut(s) 279
BlsI GCNGC 1 cut(s) 280
BmcAI AGTACT 1 cut(s) 383
Bme1390I CCNGG 2 cut(s) 175, 321
Bme18I GGWCC 1 cut(s) 235
BmgBI CACGTC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 2 cut(s) 31, 43
BmrFI CCNGG 2 cut(s) 175, 321
BpmI CTGGAG 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 312
BpuMI CCSGG 2 cut(s) 175, 321
BsaAI YACGTR 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 231
BsaXI ACNNNNNCTCC 6 cut(s) 33, 47, 63, 77, 77, 107
Bsc4I CCNNNNNNNGG 3 cut(s) 142, 174, 256
BseDI CCNNGG 1 cut(s) 231
BseLI CCNNNNNNNGG 3 cut(s) 142, 174, 256
BseRI GAGGAG 2 cut(s) 82, 229
BseXI GCAGC 1 cut(s) 265
BshNI GGYRCC 1 cut(s) 29
BsiSI CCGG 3 cut(s) 174, 320, 332
BsiWI CGTACG 1 cut(s) 78
BslFI GGGAC 1 cut(s) 371
BslI CCNNNNNNNGG 3 cut(s) 142, 174, 256
BsmAI GTCTC 1 cut(s) 257
BsmFI GGGAC 1 cut(s) 371
BspACI CCGC 3 cut(s) 27, 39, 150
BspLI GGNNCC 2 cut(s) 31, 43
BspT107I GGYRCC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 231
BssT1I CCWWGG 1 cut(s) 231
Bst4CI ACNGT 5 cut(s) 23, 203, 259, 354, 362
Bst6I CTCTTC 1 cut(s) 116
BstBAI YACGTR 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 312
BstH2I RGCGCY 1 cut(s) 160
BstHHI GCGC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 257
BstSCI CCNGG 2 cut(s) 173, 319
BstSFI CTRYAG 1 cut(s) 55
BstV1I GCAGC 1 cut(s) 265
BtrI CACGTC 1 cut(s) 106
BtsIMutI CAGTG 2 cut(s) 28, 359
CfoI GCGC 1 cut(s) 159
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 3 cut(s) 30, 79, 382
CviQI GTAC 3 cut(s) 30, 79, 382
DdeI CTNAG 1 cut(s) 312
DraIII CACNNNGTG 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
EciI GGCGGA 2 cut(s) 54, 139
Eco130I CCWWGG 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 235
Eco47III AGCGCT 1 cut(s) 158
Eco72I CACGTG 1 cut(s) 142
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaqI GGGAC 1 cut(s) 371
Fnu4HI GCNGC 1 cut(s) 279
Fsp4HI GCNGC 1 cut(s) 279
GlaI GCGC 1 cut(s) 158
GluI GCNGC 1 cut(s) 279
GsuI CTGGAG 1 cut(s) 151
HaeII RGCGCY 1 cut(s) 160
HapII CCGG 3 cut(s) 174, 320, 332
HhaI GCGC 1 cut(s) 159
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
HindIII AAGCTT 1 cut(s) 314
HinfI GANTC 2 cut(s) 48, 369
HpaII CCGG 3 cut(s) 174, 320, 332
HphI GGTGA 2 cut(s) 154, 359
Hpy166II GTNNAC 1 cut(s) 350
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 350
HpyAV CCTTC 1 cut(s) 338
HpyCH4III ACNGT 5 cut(s) 23, 203, 259, 354, 362
HpyCH4IV ACGT 2 cut(s) 105, 141
HpyF3I CTNAG 1 cut(s) 312
HpySE526I ACGT 2 cut(s) 105, 141
HspAI GCGC 1 cut(s) 157
KpnI GGTACC 1 cut(s) 33
LmnI GCTCC 3 cut(s) 41, 68, 216
LpnPI CCDG 7 cut(s) 58, 167, 181, 187, 325, 333, 345
Lsp1109I GCAGC 1 cut(s) 265
MaeII ACGT 2 cut(s) 105, 141
MaeIII GTNAC 1 cut(s) 203
MboII GAAGA 2 cut(s) 103, 141
MlyI GAGTC 1 cut(s) 57
MspI CCGG 3 cut(s) 174, 320, 332
MspR9I CCNGG 2 cut(s) 175, 321
NciI CCSGG 2 cut(s) 175, 321
NlaIV GGNNCC 2 cut(s) 31, 43
PfeI GAWTC 1 cut(s) 369
Pfl23II CGTACG 1 cut(s) 78
PfoI TCCNGGA 1 cut(s) 319
PkrI GCNGC 1 cut(s) 280
PleI GAGTC 1 cut(s) 56
PmaCI CACGTG 1 cut(s) 142
PmlI CACGTG 1 cut(s) 142
PpsI GAGTC 1 cut(s) 56
Ppu21I YACGTR 1 cut(s) 142
PspCI CACGTG 1 cut(s) 142
PspLI CGTACG 1 cut(s) 78
PspN4I GGNNCC 2 cut(s) 31, 43
PspPI GGNCC 1 cut(s) 235
RsaI GTAC 3 cut(s) 31, 80, 383
RsaNI GTAC 3 cut(s) 30, 79, 382
SatI GCNGC 1 cut(s) 279
Sau96I GGNCC 1 cut(s) 235
ScaI AGTACT 1 cut(s) 383
SchI GAGTC 1 cut(s) 57
ScrFI CCNGG 2 cut(s) 175, 321
SetI ASST 7 cut(s) 65, 90, 108, 144, 167, 318, 349
SfcI CTRYAG 1 cut(s) 55
SinI GGWCC 1 cut(s) 235
SsiI CCGC 3 cut(s) 27, 39, 150
StyD4I CCNGG 2 cut(s) 173, 319
StyI CCWWGG 1 cut(s) 231
TaaI ACNGT 5 cut(s) 23, 203, 259, 354, 362
TaiI ACGT 2 cut(s) 108, 144
TaqI TCGA 1 cut(s) 378
TatI WGTACW 1 cut(s) 381
TfiI GAWTC 1 cut(s) 369
TscAI CASTG 2 cut(s) 28, 359
TseI GCWGC 1 cut(s) 278
TspGWI ACGGA 1 cut(s) 268
TspRI CASTG 2 cut(s) 28, 359
VpaK11BI GGWCC 1 cut(s) 235
ZrmI AGTACT 1 cut(s) 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.