Rmu_co7960896.1_g000001

Fanconi anemia group J protein homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7960896.1
Physical Location & Seq
Reverse (-)
1 .. 308
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7960896.1_g000001.1.cds

Sequence Viewer

Length: 281 bp
atgcaggaaagggtaagcaagaatatggtcaatgtgtcacagagttctgacactagagagaaaatcattctttctatggatcacagtaaagggtttacaagactgaaagatcagaatttgaataaatctgatcctcagggacagacaaaaacttatgtaggcaagcacgattctctactgacatctcaagatgatcttgatgtatcatcacgaatggatgtatatgctgacaatagcaaggactttatcaatatcagatctactcctcagaaagatacaag

Protein Analysis

93

Amino Acids

10.6

Weight (kDa)

6.72

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 87, 125
AcsI RAATTY 1 cut(s) 115
AgsI TTSAA 1 cut(s) 121
AlwI GGATC 2 cut(s) 87, 125
ApoI RAATTY 1 cut(s) 115
AxyI CCTNAGG 1 cut(s) 135
BfaI CTAG 1 cut(s) 54
BglII AGATCT 1 cut(s) 257
BpuEI CTTGAG 1 cut(s) 171
Bse21I CCTNAGG 1 cut(s) 135
BseGI GGATG 1 cut(s) 223
BseMII CTCAG 2 cut(s) 149, 281
BseRI GAGGAG 1 cut(s) 255
BslFI GGGAC 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 153
Bsp143I GATC 5 cut(s) 79, 109, 130, 193, 257
BspCNI CTCAG 2 cut(s) 148, 280
BspPI GGATC 2 cut(s) 87, 125
BssMI GATC 5 cut(s) 79, 109, 130, 193, 257
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 164
BstDEI CTNAG 2 cut(s) 135, 267
BstF5I GGATG 1 cut(s) 223
BstKTI GATC 5 cut(s) 82, 112, 133, 196, 260
BstMBI GATC 5 cut(s) 79, 109, 130, 193, 257
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
Bsu36I CCTNAGG 1 cut(s) 135
BtsCI GGATG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 164
DdeI CTNAG 2 cut(s) 135, 267
DpnI GATC 5 cut(s) 81, 111, 132, 195, 259
DpnII GATC 5 cut(s) 79, 109, 130, 193, 257
Eco81I CCTNAGG 1 cut(s) 135
FaiI YATR 5 cut(s) 26, 77, 156, 223, 225
FalI AAGNNNNNCTT 2 cut(s) 180, 212
FaqI GGGAC 1 cut(s) 153
FokI GGATG 1 cut(s) 230
FspBI CTAG 1 cut(s) 54
HinfI GANTC 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 5 cut(s) 49, 114, 130, 257, 270
Hpy188III TCNNGA 3 cut(s) 188, 197, 210
Hpy8I GTNNAC 1 cut(s) 96
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 135, 267
Kzo9I GATC 5 cut(s) 79, 109, 130, 193, 257
LpnPI CCDG 1 cut(s) 122
MaeI CTAG 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 36
MalI GATC 5 cut(s) 81, 111, 132, 195, 259
MboI GATC 5 cut(s) 79, 109, 130, 193, 257
MflI RGATCY 1 cut(s) 257
MluCI AATT 1 cut(s) 115
MnlI CCTC 2 cut(s) 144, 276
NdeII GATC 5 cut(s) 79, 109, 130, 193, 257
NmuCI GTSAC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 170
PsuI RGATCY 1 cut(s) 257
Sau3AI GATC 5 cut(s) 79, 109, 130, 193, 257
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 1 cut(s) 115
SspMI CTAG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 86
TasI AATT 1 cut(s) 115
TfiI GAWTC 1 cut(s) 170
TseFI GTSAC 1 cut(s) 36
Tsp45I GTSAC 1 cut(s) 36
XapI RAATTY 1 cut(s) 115
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.