Rmu_co7974714.1_g000001

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7974714.1
OG0017647
Physical Location & Seq
Reverse (-)
2 .. 376
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7974714.1_g000001.1.cds

Sequence Viewer

Length: 375 bp
atgggttttgcacagaagtggattgatactgttctgtgttctattagaacagtgggctattctattcttttgcatggtacacctacaggttttctatttggggaagcatctgtttcagaatgtgctaccctcaagtccatcctggatgtttatgagcgtgcttcttgtcaaaaggttaacctggagaaaagcaatgttgtcttcagtaagaatgtgcatcctcatgtcaaagttcatttagcttctattttagaggtgcagtgtgttgaggatcatggcagatatctagggctaccccttcatgttgggaaatcaaaaacggcaattttctcttacttaaaggaaagactgacaaagaagttgatcagctggcgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

125

Amino Acids

14.02

Weight (kDa)

9.28

Isoelectric Point (pI)

10.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 279
AcuI CTGAAG 1 cut(s) 187
AfaI GTAC 1 cut(s) 79
AjnI CCWGG 2 cut(s) 141, 180
AleI CACNNNNGTG 1 cut(s) 16
AluBI AGCT 2 cut(s) 242, 369
AluI AGCT 2 cut(s) 242, 369
AlwI GGATC 1 cut(s) 279
AspLEI GCGC 1 cut(s) 375
BbsI GAAGAC 1 cut(s) 193
BccI CCATC 1 cut(s) 146
BceAI ACGGC 1 cut(s) 336
BciT130I CCWGG 2 cut(s) 143, 182
BclI TGATCA 1 cut(s) 363
BfaI CTAG 1 cut(s) 287
BfmI CTRYAG 1 cut(s) 84
Bme1390I CCNGG 2 cut(s) 143, 182
BmrFI CCNGG 2 cut(s) 143, 182
BmsI GCATC 2 cut(s) 116, 226
BpiI GAAGAC 1 cut(s) 193
BpmI CTGGAG 1 cut(s) 203
BpuEI CTTGAG 1 cut(s) 116
Bse3DI GCAATG 1 cut(s) 199
BseBI CCWGG 2 cut(s) 143, 182
BseGI GGATG 3 cut(s) 138, 151, 217
BseMI GCAATG 1 cut(s) 199
BsgI GTGCAG 1 cut(s) 278
Bsp143I GATC 2 cut(s) 271, 363
BspPI GGATC 1 cut(s) 279
BsrDI GCAATG 1 cut(s) 199
BssMI GATC 2 cut(s) 271, 363
Bst2UI CCWGG 2 cut(s) 143, 182
Bst4CI ACNGT 2 cut(s) 31, 52
BstC8I GCNNGC 2 cut(s) 159, 371
BstF5I GGATG 3 cut(s) 138, 151, 217
BstHHI GCGC 1 cut(s) 375
BstKTI GATC 2 cut(s) 274, 366
BstMBI GATC 2 cut(s) 271, 363
BstNI CCWGG 2 cut(s) 143, 182
BstSCI CCNGG 2 cut(s) 141, 180
BstSFI CTRYAG 1 cut(s) 84
BstV2I GAAGAC 1 cut(s) 193
BtsCI GGATG 3 cut(s) 138, 151, 217
BtsI GCAGTG 1 cut(s) 266
BtsIMutI CAGTG 2 cut(s) 57, 266
Cac8I GCNNGC 2 cut(s) 159, 371
CfoI GCGC 1 cut(s) 375
Csp6I GTAC 1 cut(s) 78
CviAII CATG 4 cut(s) 74, 224, 275, 302
CviJI RGCY 4 cut(s) 57, 242, 292, 369
CviKI_1 RGCY 4 cut(s) 57, 242, 292, 369
CviQI GTAC 1 cut(s) 78
DpnI GATC 2 cut(s) 273, 365
DpnII GATC 2 cut(s) 271, 363
Eco32I GATATC 1 cut(s) 284
Eco57I CTGAAG 1 cut(s) 187
EcoRII CCWGG 2 cut(s) 141, 180
EcoRV GATATC 1 cut(s) 284
FaeI CATG 4 cut(s) 77, 227, 278, 305
FaiI YATR 5 cut(s) 75, 153, 225, 276, 303
FatI CATG 4 cut(s) 73, 223, 274, 301
FbaI TGATCA 1 cut(s) 363
FokI GGATG 3 cut(s) 125, 158, 204
FspBI CTAG 1 cut(s) 287
GlaI GCGC 1 cut(s) 374
GsuI CTGGAG 1 cut(s) 203
HhaI GCGC 1 cut(s) 375
Hin1II CATG 4 cut(s) 77, 227, 278, 305
Hin6I GCGC 1 cut(s) 373
HinP1I GCGC 1 cut(s) 373
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HpaI GTTAAC 1 cut(s) 178
Hpy166II GTNNAC 2 cut(s) 80, 178
Hpy188I TCNGA 1 cut(s) 118
Hpy8I GTNNAC 2 cut(s) 80, 178
HpyAV CCTTC 1 cut(s) 308
HpyCH4III ACNGT 2 cut(s) 31, 52
HpyCH4V TGCA 4 cut(s) 11, 73, 217, 259
Hsp92II CATG 4 cut(s) 77, 227, 278, 305
HspAI GCGC 1 cut(s) 373
Ksp22I TGATCA 1 cut(s) 363
KspAI GTTAAC 1 cut(s) 178
Kzo9I GATC 2 cut(s) 271, 363
LpnPI CCDG 6 cut(s) 72, 128, 155, 167, 194, 355
LweI GCATC 2 cut(s) 116, 226
MaeI CTAG 1 cut(s) 287
MalI GATC 2 cut(s) 273, 365
MboI GATC 2 cut(s) 271, 363
MboII GAAGA 1 cut(s) 193
MluCI AATT 1 cut(s) 324
MnlI CCTC 4 cut(s) 140, 231, 247, 262
MseI TTAA 2 cut(s) 177, 338
MslI CAYNNNNRTG 2 cut(s) 16, 222
MspA1I CMGCKG 1 cut(s) 369
MspR9I CCNGG 2 cut(s) 143, 182
MvaI CCWGG 2 cut(s) 143, 182
NdeII GATC 2 cut(s) 271, 363
NlaIII CATG 4 cut(s) 77, 227, 278, 305
OliI CACNNNNGTG 1 cut(s) 16
PfoI TCCNGGA 1 cut(s) 141
Psp6I CCWGG 2 cut(s) 141, 180
PspGI CCWGG 2 cut(s) 141, 180
PvuII CAGCTG 1 cut(s) 369
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
RseI CAYNNNNRTG 2 cut(s) 16, 222
SaqAI TTAA 2 cut(s) 177, 338
Sau3AI GATC 2 cut(s) 271, 363
ScrFI CCNGG 2 cut(s) 143, 182
SetI ASST 7 cut(s) 85, 91, 177, 183, 244, 258, 371
SfaNI GCATC 2 cut(s) 116, 226
SfcI CTRYAG 1 cut(s) 84
SmiMI CAYNNNNRTG 2 cut(s) 16, 222
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 324
SspMI CTAG 1 cut(s) 287
StyD4I CCNGG 2 cut(s) 141, 180
TaaI ACNGT 2 cut(s) 31, 52
TasI AATT 1 cut(s) 324
Tru1I TTAA 2 cut(s) 177, 338
Tru9I TTAA 2 cut(s) 177, 338
TscAI CASTG 2 cut(s) 57, 266
TspDTI ATGAA 2 cut(s) 224, 290
TspRI CASTG 2 cut(s) 57, 266
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.