Rmu_sc0004516.1_g000004

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004516.1
OG0017647
Physical Location & Seq
Forward (+)
23225 .. 23584
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004516.1_g000004.1.cds

Sequence Viewer

Length: 360 bp
atggctactctagaggaatgtcagcaaattagaaatattctgtatacctttgaacttgcttcagggcaaaaggtaaatctgaagaagagtagtgttgctttttctaaaaatgttcacttgcagactcaggagactctagcggcaattttgggtgtccaatgtgctgataagcatgagaggtatctagggttccctacacatgtgggaagatctaaaacagaagcttttgattacttgaaagagaagctctcaaagaaaattgtcagttggaaatccaagttgcttagtgaaggcggtaaggaaattctaattaaggctgtgacgcaggcagtacctatgtatgtgattgacatgttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 zf-RVT

Protein Analysis

119

Amino Acids

13.4

Weight (kDa)

9.25

Isoelectric Point (pI)

37.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 44
AciI CCGC 2 cut(s) 140, 294
AcsI RAATTY 1 cut(s) 303
AcuI CTGAAG 2 cut(s) 45, 101
AfaI GTAC 1 cut(s) 333
AflIII ACRYGT 2 cut(s) 199, 351
AgsI TTSAA 2 cut(s) 53, 238
AluBI AGCT 2 cut(s) 224, 247
AluI AGCT 2 cut(s) 224, 247
Alw26I GTCTC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 303
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 3 cut(s) 11, 137, 185
BglII AGATCT 1 cut(s) 209
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 191
BplI GAGNNNNNCTC 2 cut(s) 233, 265
BseMII CTCAG 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 209
BspACI CCGC 2 cut(s) 140, 294
BspCNI CTCAG 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 191
BssMI GATC 1 cut(s) 209
BssNAI GTATAC 1 cut(s) 45
Bst1107I GTATAC 1 cut(s) 45
Bst6I CTCTTC 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 327
BstDEI CTNAG 2 cut(s) 126, 284
BstKTI GATC 1 cut(s) 212
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 1 cut(s) 209
BstNSI RCATGY 2 cut(s) 203, 355
BstX2I RGATCY 1 cut(s) 209
BstYI RGATCY 1 cut(s) 209
BstZ17I GTATAC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 327
CseI GACGC 1 cut(s) 331
Csp6I GTAC 1 cut(s) 332
CviAII CATG 3 cut(s) 173, 200, 352
CviJI RGCY 4 cut(s) 5, 224, 247, 317
CviKI_1 RGCY 4 cut(s) 5, 224, 247, 317
CviQI GTAC 1 cut(s) 332
DdeI CTNAG 2 cut(s) 126, 284
DpnI GATC 1 cut(s) 211
DpnII GATC 1 cut(s) 209
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco57I CTGAAG 2 cut(s) 45, 101
FaeI CATG 3 cut(s) 176, 203, 355
FaiI YATR 6 cut(s) 45, 174, 201, 338, 342, 353
FatI CATG 3 cut(s) 172, 199, 351
FblI GTMKAC 1 cut(s) 44
Fnu4HI GCNGC 1 cut(s) 141
Fsp4HI GCNGC 1 cut(s) 141
FspBI CTAG 3 cut(s) 11, 137, 185
GluI GCNGC 1 cut(s) 141
HgaI GACGC 1 cut(s) 331
Hin1II CATG 3 cut(s) 176, 203, 355
HindIII AAGCTT 1 cut(s) 222
HinfI GANTC 2 cut(s) 124, 133
Hpy166II GTNNAC 2 cut(s) 45, 115
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 11, 128
Hpy8I GTNNAC 2 cut(s) 45, 115
HpyAV CCTTC 1 cut(s) 284
HpyCH4V TGCA 1 cut(s) 121
HpyF3I CTNAG 2 cut(s) 126, 284
Hsp92II CATG 3 cut(s) 176, 203, 355
Kzo9I GATC 1 cut(s) 209
LpnPI CCDG 3 cut(s) 48, 113, 311
MaeI CTAG 3 cut(s) 11, 137, 185
MaeIII GTNAC 1 cut(s) 319
MalI GATC 1 cut(s) 211
MboI GATC 1 cut(s) 209
MboII GAAGA 3 cut(s) 94, 97, 219
MflI RGATCY 1 cut(s) 209
MluCI AATT 5 cut(s) 27, 144, 258, 303, 309
MlyI GAGTC 2 cut(s) 118, 127
MmeI TCCRAC 1 cut(s) 248
MnlI CCTC 2 cut(s) 7, 171
MseI TTAA 1 cut(s) 312
NdeII GATC 1 cut(s) 209
NlaIII CATG 3 cut(s) 176, 203, 355
NlaIV GGNNCC 1 cut(s) 191
NmuCI GTSAC 1 cut(s) 319
NspI RCATGY 2 cut(s) 203, 355
PciI ACATGT 2 cut(s) 199, 351
PkrI GCNGC 1 cut(s) 142
PleI GAGTC 2 cut(s) 118, 127
PpsI GAGTC 2 cut(s) 118, 127
PscI ACATGT 2 cut(s) 199, 351
PspN4I GGNNCC 1 cut(s) 191
PsrI GAACNNNNNNTAC 2 cut(s) 173, 205
PsuI RGATCY 1 cut(s) 209
RsaI GTAC 1 cut(s) 333
RsaNI GTAC 1 cut(s) 332
SaqAI TTAA 1 cut(s) 312
SatI GCNGC 1 cut(s) 141
Sau3AI GATC 1 cut(s) 209
SchI GAGTC 2 cut(s) 118, 127
SetI ASST 6 cut(s) 50, 75, 182, 226, 249, 337
Sse9I AATT 5 cut(s) 27, 144, 258, 303, 309
SsiI CCGC 2 cut(s) 140, 294
SspI AATATT 1 cut(s) 37
SspMI CTAG 3 cut(s) 11, 137, 185
TasI AATT 5 cut(s) 27, 144, 258, 303, 309
TauI GCSGC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TseFI GTSAC 1 cut(s) 319
Tsp45I GTSAC 1 cut(s) 319
XapI RAATTY 1 cut(s) 303
XbaI TCTAGA 1 cut(s) 10
XceI RCATGY 2 cut(s) 203, 355
XmiI GTMKAC 1 cut(s) 44
XspI CTAG 3 cut(s) 11, 137, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.