Rmu_co7993828.1_g000001

Decapping 5-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7993828.1
Physical Location & Seq
Forward (+)
1 .. 442
442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7993828.1_g000001.1.cds

Sequence Viewer

Length: 282 bp
cctgtctacaataaggatgatttctttgacaccatctcctccaattctttcaataatgaacagaatggaaggactcggtactctgagcaaataaagatagatacagagacttttggaacattttcaaggtatcggggtggtcgaggtggccgtggtcctggacgtggtggccggggccgtgggggttactatggaagggactatggaagggattatggaaggggatatggctatgttggaaggggccgtggccgagggatgtctagtcaaggccctcagtaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.37

Weight (kDa)

10.21

Isoelectric Point (pI)

19.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 6
AcoI YGGCCR 3 cut(s) 148, 169, 250
AfaI GTAC 1 cut(s) 80
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 52, 126
AjiI CACGTC 1 cut(s) 164
AjnI CCWGG 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 101
AoxI GGCC 6 cut(s) 148, 169, 175, 244, 250, 271
Asp700I GAANNNNTTC 1 cut(s) 121
AspS9I GGNCC 4 cut(s) 155, 175, 244, 272
AsuC2I CCSGG 1 cut(s) 173
AvaII GGWCC 1 cut(s) 155
BccI CCATC 1 cut(s) 41
BceAI ACGGC 3 cut(s) 135, 162, 231
BciT130I CCWGG 1 cut(s) 159
BcnI CCSGG 1 cut(s) 173
BcoDI GTCTC 1 cut(s) 101
BfaI CTAG 1 cut(s) 264
Bme1390I CCNGG 2 cut(s) 159, 173
Bme18I GGWCC 1 cut(s) 155
BmgBI CACGTC 1 cut(s) 164
BmgT120I GGNCC 4 cut(s) 155, 175, 244, 272
BmiI GGNNCC 2 cut(s) 176, 245
BmrFI CCNGG 2 cut(s) 159, 173
BpuMI CCSGG 1 cut(s) 173
BsaJI CCNNGG 5 cut(s) 151, 172, 178, 247, 253
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 5 cut(s) 151, 172, 178, 247, 253
BseGI GGATG 2 cut(s) 22, 264
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 28
BshFI GGCC 6 cut(s) 150, 171, 177, 246, 252, 273
BsiSI CCGG 1 cut(s) 172
BslFI GGGAC 1 cut(s) 212
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 212
BsnI GGCC 6 cut(s) 150, 171, 177, 246, 252, 273
BspANI GGCC 6 cut(s) 150, 171, 177, 246, 252, 273
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 2 cut(s) 176, 245
BssECI CCNNGG 5 cut(s) 151, 172, 178, 247, 253
Bst2UI CCWGG 1 cut(s) 159
BstDEI CTNAG 2 cut(s) 84, 276
BstDSI CCRYGG 3 cut(s) 151, 178, 247
BstF5I GGATG 2 cut(s) 22, 264
BstMAI GTCTC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 2 cut(s) 157, 171
BsuRI GGCC 6 cut(s) 150, 171, 177, 246, 252, 273
BtgI CCRYGG 3 cut(s) 151, 178, 247
BtrI CACGTC 1 cut(s) 164
BtsCI GGATG 2 cut(s) 22, 264
Cfr13I GGNCC 4 cut(s) 155, 175, 244, 272
Csp6I GTAC 1 cut(s) 79
CviJI RGCY 7 cut(s) 150, 171, 177, 231, 246, 252, 273
CviKI_1 RGCY 7 cut(s) 150, 171, 177, 231, 246, 252, 273
CviQI GTAC 1 cut(s) 79
DdeI CTNAG 2 cut(s) 84, 276
EaeI YGGCCR 3 cut(s) 148, 169, 250
Eco47I GGWCC 1 cut(s) 155
EcoO109I RGGNCCY 1 cut(s) 272
EcoRII CCWGG 1 cut(s) 157
FaiI YATR 5 cut(s) 192, 204, 216, 228, 234
FaqI GGGAC 1 cut(s) 212
FblI GTMKAC 1 cut(s) 6
FokI GGATG 2 cut(s) 29, 271
FspBI CTAG 1 cut(s) 264
HaeIII GGCC 6 cut(s) 150, 171, 177, 246, 252, 273
HapII CCGG 1 cut(s) 172
HinfI GANTC 1 cut(s) 73
HpaII CCGG 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 1 cut(s) 85
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 5 cut(s) 63, 189, 201, 213, 234
HpyCH4IV ACGT 1 cut(s) 163
HpyF3I CTNAG 2 cut(s) 84, 276
HpySE526I ACGT 1 cut(s) 163
LpnPI CCDG 4 cut(s) 15, 144, 171, 185
MaeI CTAG 1 cut(s) 264
MaeII ACGT 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 185
MluCI AATT 1 cut(s) 43
MlyI GAGTC 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 217
MnlI CCTC 3 cut(s) 49, 137, 248
MroXI GAANNNNTTC 1 cut(s) 121
MspI CCGG 1 cut(s) 172
MspR9I CCNGG 2 cut(s) 159, 173
MvaI CCWGG 1 cut(s) 159
NciI CCSGG 1 cut(s) 173
NlaIV GGNNCC 2 cut(s) 176, 245
NmeAIII GCCGAG 1 cut(s) 278
PcsI WCGNNNNNNNCGW 2 cut(s) 139, 148
PdmI GAANNNNTTC 1 cut(s) 121
PfoI TCCNGGA 1 cut(s) 157
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 2 cut(s) 176, 245
PspPI GGNCC 4 cut(s) 155, 175, 244, 272
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
Sau96I GGNCC 4 cut(s) 155, 175, 244, 272
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 159, 173
SetI ASST 3 cut(s) 131, 148, 166
SinI GGWCC 1 cut(s) 155
Sse9I AATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 264
StyD4I CCNGG 2 cut(s) 157, 171
TaiI ACGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 6
XmnI GAANNNNTTC 1 cut(s) 121
XspI CTAG 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.