Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8001390.1

Orthogroup ID

OG0013527

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 503

Gene Structure 503 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8001390.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 265 bp

atgtctgcaggaccaagaaggttcttatttcgccatacattgggtcgatttcagagcctcgaggcaaaatttgccaaagctgagaagaatgtaaaccagttcaaactttcagttgatctgatgaagcaggagagcaagaaacttcttgagagggcagcttttgctgaaaaggaaatgaaatttggccaaactgaactcaaggatgtgggaagtcgaattcaatctctatccaaatctattcgcaaggttgacgcccaagctgcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001678 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0008150 GO:0009743 GO:0009746 GO:0009749 GO:0009966 GO:0009987 GO:0010033 GO:0010646 GO:0019725 GO:0023051 GO:0033500 GO:0034284 GO:0042221 GO:0042592 GO:0042593 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048583 GO:0048878 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055082 GO:0065007 GO:0065008 GO:0070887 GO:0071310 GO:0071322 GO:0071326 GO:0071331 GO:0071333 GO:1901700 GO:1901701 GO:1902659

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

88

Amino Acids

10.03

Weight (kDa)

10.28

Isoelectric Point (pI)

31.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013527)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26410
fragaria_vesca	FvH4_3g45950 FvH4_3g45950 FvH4_3g45950
malus_domestica	MD11G1001100.v1.1
prunus_persica	Prupe.6G001300_v2.0.a1
pyrus_communis	pycom11g00130
rosa_chinensis	RchiOBHm_Chr5g0084061
rosa_laevigata	RLG00000037078
rosa_multiflora	Rmu_co8001390.1_g000001 Rmu_ssc0000372.1_g000088
rosa_roxburghii	Rroxscaffold_1G00000600
rosa_rugosa	Rorug05G0488800
rosa_samantha	Rh5AG541400 Rh5BG566700 Rh5CG588700 Rh5DG575100
rosa_wichuraiana	Rw5G050350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AbsI	CCTCGAGG	1 cut(s)	59
AccB7I	CCANNNNNTGG	1 cut(s)	40
AcoI	YGGCCR	1 cut(s)	184
AcsI	RAATTY	3 cut(s)	68, 179, 216
AcyI	GRCGYC	1 cut(s)	252
AfiI	CCNNNNNNNGG	1 cut(s)	40
AgsI	TTSAA	2 cut(s)	103, 221
AjuI	GAANNNNNNNTTGG	2 cut(s)	165, 197
AluBI	AGCT	3 cut(s)	80, 158, 260
AluI	AGCT	3 cut(s)	80, 158, 260
Ama87I	CYCGRG	1 cut(s)	59
AoxI	GGCC	1 cut(s)	184
ApeKI	GCWGC	2 cut(s)	155, 260
ApoI	RAATTY	3 cut(s)	68, 179, 216
AspS9I	GGNCC	1 cut(s)	11
AvaI	CYCGRG	1 cut(s)	59
AvaII	GGWCC	1 cut(s)	11
BalI	TGGCCA	1 cut(s)	186
BbvI	GCAGC	2 cut(s)	167, 247
BfmI	CTRYAG	2 cut(s)	6, 261
BisI	GCNGC	2 cut(s)	156, 261
BlsI	GCNGC	2 cut(s)	157, 262
Bme18I	GGWCC	1 cut(s)	11
BmeT110I	CYCGRG	1 cut(s)	59
BmgT120I	GGNCC	1 cut(s)	11
BpuEI	CTTGAG	2 cut(s)	167, 182
BsaHI	GRCGYC	1 cut(s)	252
Bsc4I	CCNNNNNNNGG	1 cut(s)	40
Bse1I	ACTGG	1 cut(s)	97
BseGI	GGATG	1 cut(s)	208
BseLI	CCNNNNNNNGG	1 cut(s)	40
BseMII	CTCAG	1 cut(s)	72
BseNI	ACTGG	1 cut(s)	97
BseXI	GCAGC	2 cut(s)	167, 247
BshFI	GGCC	1 cut(s)	186
BsiHKCI	CYCGRG	1 cut(s)	59
BslI	CCNNNNNNNGG	1 cut(s)	40
BsnI	GGCC	1 cut(s)	186
BsoBI	CYCGRG	1 cut(s)	59
Bsp143I	GATC	1 cut(s)	115
BspANI	GGCC	1 cut(s)	186
BspCNI	CTCAG	1 cut(s)	73
BspMAI	CTGCAG	2 cut(s)	10, 265
BsrI	ACTGG	1 cut(s)	97
BssMI	GATC	1 cut(s)	115
BssNI	GRCGYC	1 cut(s)	252
BstACI	GRCGYC	1 cut(s)	252
BstAPI	GCANNNNNTGC	2 cut(s)	71, 161
BstDEI	CTNAG	1 cut(s)	81
BstF5I	GGATG	1 cut(s)	208
BstKTI	GATC	1 cut(s)	118
BstMBI	GATC	1 cut(s)	115
BstMWI	GCNNNNNNNGC	3 cut(s)	71, 161, 260
BstSFI	CTRYAG	2 cut(s)	6, 261
BstV1I	GCAGC	2 cut(s)	167, 247
BsuRI	GGCC	1 cut(s)	186
BtsCI	GGATG	1 cut(s)	208
Cfr13I	GGNCC	1 cut(s)	11
CseI	GACGC	1 cut(s)	260
CviJI	RGCY	5 cut(s)	57, 80, 158, 186, 260
CviKI_1	RGCY	5 cut(s)	57, 80, 158, 186, 260
DdeI	CTNAG	1 cut(s)	81
DpnI	GATC	1 cut(s)	117
DpnII	GATC	1 cut(s)	115
EaeI	YGGCCR	1 cut(s)	184
Eco47I	GGWCC	1 cut(s)	11
Eco88I	CYCGRG	1 cut(s)	59
EcoRI	GAATTC	1 cut(s)	216
FaiI	YATR	1 cut(s)	36
Fnu4HI	GCNGC	2 cut(s)	156, 261
FokI	GGATG	1 cut(s)	215
Fsp4HI	GCNGC	2 cut(s)	156, 261
GluI	GCNGC	2 cut(s)	156, 261
HaeIII	GGCC	1 cut(s)	186
HgaI	GACGC	1 cut(s)	260
Hin1I	GRCGYC	1 cut(s)	252
HincII	GTYRAC	1 cut(s)	250
HindII	GTYRAC	1 cut(s)	250
Hpy166II	GTNNAC	2 cut(s)	94, 250
Hpy188I	TCNGA	2 cut(s)	54, 120
Hpy188III	TCNNGA	1 cut(s)	146
Hpy8I	GTNNAC	2 cut(s)	94, 250
HpyAV	CCTTC	1 cut(s)	12
HpyCH4V	TGCA	2 cut(s)	8, 263
HpyF10VI	GCNNNNNNNGC	3 cut(s)	71, 161, 260
HpyF3I	CTNAG	1 cut(s)	81
Hsp92I	GRCGYC	1 cut(s)	252
Kzo9I	GATC	1 cut(s)	115
LpnPI	CCDG	2 cut(s)	110, 113
Lsp1109I	GCAGC	2 cut(s)	167, 247
MalI	GATC	1 cut(s)	117
MboI	GATC	1 cut(s)	115
MboII	GAAGA	1 cut(s)	97
MlsI	TGGCCA	1 cut(s)	186
MluCI	AATT	3 cut(s)	68, 179, 216
MluNI	TGGCCA	1 cut(s)	186
MnlI	CCTC	3 cut(s)	55, 68, 144
Mox20I	TGGCCA	1 cut(s)	186
MscI	TGGCCA	1 cut(s)	186
Msp20I	TGGCCA	1 cut(s)	186
MwoI	GCNNNNNNNGC	3 cut(s)	71, 161, 260
NdeII	GATC	1 cut(s)	115
PaeR7I	CTCGAG	1 cut(s)	59
PflMI	CCANNNNNTGG	1 cut(s)	40
PkrI	GCNGC	2 cut(s)	157, 262
PspPI	GGNCC	1 cut(s)	11
PspXI	VCTCGAGB	1 cut(s)	59
PstI	CTGCAG	2 cut(s)	10, 265
SatI	GCNGC	2 cut(s)	156, 261
Sau3AI	GATC	1 cut(s)	115
Sau96I	GGNCC	1 cut(s)	11
SetI	ASST	5 cut(s)	23, 82, 160, 249, 262
SfcI	CTRYAG	2 cut(s)	6, 261
Sfr274I	CTCGAG	1 cut(s)	59
SinI	GGWCC	1 cut(s)	11
SlaI	CTCGAG	1 cut(s)	59
SmlI	CTYRAG	3 cut(s)	59, 146, 197
SmoI	CTYRAG	3 cut(s)	59, 146, 197
Sse9I	AATT	3 cut(s)	68, 179, 216
TaqI	TCGA	3 cut(s)	46, 60, 214
TasI	AATT	3 cut(s)	68, 179, 216
TseI	GCWGC	2 cut(s)	155, 260
TspDTI	ATGAA	2 cut(s)	137, 191
Van91I	CCANNNNNTGG	1 cut(s)	40
VpaK11BI	GGWCC	1 cut(s)	11
XapI	RAATTY	3 cut(s)	68, 179, 216
XhoI	CTCGAG	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.