Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8025450.1

Orthogroup ID

OG0018090

Physical Location & Seq

Genomic Coordinates Forward (+)

141 .. 542

Gene Structure 402 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8025450.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 402 bp

atggatatggaggctgctgcagttaattattataataattatgttttagggtcatcaccatccagaagctgctcagttccggaccaacagctactatatcatcatgggcatggacttggatatgattatgatgatttaactagtgcaaccatgatgaatcgtcattctagttgtctccaaggtacttctttcgggactagtgagtatgatcatcatgattccaagtttgccattccaaatatgaaagttccatttagtactgatgatcatcatcataagctgcagtatggtgaggctggtcatcatgatcatcaattgcctgttttggtttcagcagccacctcggcctacgtcactatcactcatgatactactgctgctaatgatcaatttgctacccca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0008150 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031326 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0048869 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

134

Amino Acids

14.8

Weight (kDa)

5.56

Isoelectric Point (pI)

45.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018090)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g34130
rosa_chinensis	RchiOBHm_Chr1g0384441
rosa_laevigata	RLG00000026040
rosa_multiflora	Rmu_co8025450.1_g000001 Rmu_sc0013987.1_g000006 Rmu_sc0016737.1_g000015
rosa_roxburghii	Rroxscaffold_4G00276700
rosa_rugosa	Rorug01G0447700
rosa_samantha	Rh1BG430900 Rh1CG444100
rosa_wichuraiana	Rw1G039960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	33
AccIII	TCCGGA	1 cut(s)	79
AfaI	GTAC	2 cut(s)	184, 259
AhlI	ACTAGT	2 cut(s)	140, 197
AluBI	AGCT	3 cut(s)	69, 91, 280
AluI	AGCT	3 cut(s)	69, 91, 280
Alw26I	GTCTC	1 cut(s)	179
AlwNI	CAGNNNCTG	1 cut(s)	69
Aor13HI	TCCGGA	1 cut(s)	79
AoxI	GGCC	1 cut(s)	345
ApeKI	GCWGC	6 cut(s)	14, 17, 69, 280, 335, 377
AspS9I	GGNCC	1 cut(s)	82
AsuHPI	GGTGA	2 cut(s)	48, 302
AvaII	GGWCC	1 cut(s)	82
BbvI	GCAGC	5 cut(s)	4, 56, 267, 347, 364
BccI	CCATC	1 cut(s)	67
BcgI	CGANNNNNNTGC	2 cut(s)	324, 358
BclI	TGATCA	4 cut(s)	208, 265, 307, 385
BcoDI	GTCTC	1 cut(s)	179
BcuI	ACTAGT	2 cut(s)	140, 197
BfaI	CTAG	3 cut(s)	141, 168, 198
BfmI	CTRYAG	2 cut(s)	18, 281
BglI	GCCNNNNNGGC	1 cut(s)	344
BisI	GCNGC	6 cut(s)	15, 18, 70, 281, 336, 378
BlsI	GCNGC	6 cut(s)	16, 19, 71, 282, 337, 379
BmcAI	AGTACT	1 cut(s)	259
Bme18I	GGWCC	1 cut(s)	82
BmgT120I	GGNCC	1 cut(s)	82
BsaBI	GATNNNNATC	2 cut(s)	267, 270
BsaJI	CCNNGG	2 cut(s)	178, 342
BsaWI	WCCGGW	1 cut(s)	79
Bse8I	GATNNNNATC	2 cut(s)	267, 270
BseAI	TCCGGA	1 cut(s)	79
BseDI	CCNNGG	2 cut(s)	178, 342
BseGI	GGATG	1 cut(s)	59
BseJI	GATNNNNATC	2 cut(s)	267, 270
BseMII	CTCAG	1 cut(s)	87
BseXI	GCAGC	5 cut(s)	4, 56, 267, 347, 364
BshFI	GGCC	1 cut(s)	347
BsiSI	CCGG	1 cut(s)	80
BslFI	GGGAC	1 cut(s)	208
BsmAI	GTCTC	1 cut(s)	179
BsmFI	GGGAC	1 cut(s)	208
BsnI	GGCC	1 cut(s)	347
Bsp13I	TCCGGA	1 cut(s)	79
Bsp143I	GATC	4 cut(s)	208, 265, 307, 385
BspANI	GGCC	1 cut(s)	347
BspCNI	CTCAG	1 cut(s)	86
BspEI	TCCGGA	1 cut(s)	79
BspHI	TCATGA	3 cut(s)	214, 304, 364
BspMAI	CTGCAG	2 cut(s)	22, 285
BssECI	CCNNGG	2 cut(s)	178, 342
BssMI	GATC	4 cut(s)	208, 265, 307, 385
BssT1I	CCWWGG	1 cut(s)	178
BstDEI	CTNAG	1 cut(s)	73
BstF5I	GGATG	1 cut(s)	59
BstKTI	GATC	4 cut(s)	211, 268, 310, 388
BstMAI	GTCTC	1 cut(s)	179
BstMBI	GATC	4 cut(s)	208, 265, 307, 385
BstMWI	GCNNNNNNNGC	1 cut(s)	344
BstSFI	CTRYAG	2 cut(s)	18, 281
BstV1I	GCAGC	5 cut(s)	4, 56, 267, 347, 364
BsuRI	GGCC	1 cut(s)	347
BtsCI	GGATG	1 cut(s)	59
CaiI	CAGNNNCTG	1 cut(s)	69
CciI	TCATGA	3 cut(s)	214, 304, 364
Cfr13I	GGNCC	1 cut(s)	82
Csp6I	GTAC	2 cut(s)	183, 258
CviAII	CATG	6 cut(s)	104, 110, 151, 215, 305, 365
CviJI	RGCY	7 cut(s)	14, 69, 91, 280, 296, 338, 347
CviKI_1	RGCY	7 cut(s)	14, 69, 91, 280, 296, 338, 347
CviQI	GTAC	2 cut(s)	183, 258
DdeI	CTNAG	1 cut(s)	73
DpnI	GATC	4 cut(s)	210, 267, 309, 387
DpnII	GATC	4 cut(s)	208, 265, 307, 385
Eco130I	CCWWGG	1 cut(s)	178
Eco47I	GGWCC	1 cut(s)	82
EcoT14I	CCWWGG	1 cut(s)	178
ErhI	CCWWGG	1 cut(s)	178
FaeI	CATG	6 cut(s)	107, 113, 154, 218, 308, 368
FaqI	GGGAC	1 cut(s)	208
FatI	CATG	6 cut(s)	103, 109, 150, 214, 304, 364
FbaI	TGATCA	4 cut(s)	208, 265, 307, 385
Fnu4HI	GCNGC	6 cut(s)	15, 18, 70, 281, 336, 378
FokI	GGATG	1 cut(s)	46
Fsp4HI	GCNGC	6 cut(s)	15, 18, 70, 281, 336, 378
FspBI	CTAG	3 cut(s)	141, 168, 198
GluI	GCNGC	6 cut(s)	15, 18, 70, 281, 336, 378
HaeIII	GGCC	1 cut(s)	347
HapII	CCGG	1 cut(s)	80
Hin1II	CATG	6 cut(s)	107, 113, 154, 218, 308, 368
HinfI	GANTC	2 cut(s)	157, 218
HpaII	CCGG	1 cut(s)	80
HphI	GGTGA	2 cut(s)	48, 302
Hpy188III	TCNNGA	6 cut(s)	63, 80, 193, 215, 305, 365
HpyCH4IV	ACGT	1 cut(s)	351
HpyCH4V	TGCA	3 cut(s)	20, 146, 283
HpyF10VI	GCNNNNNNNGC	1 cut(s)	344
HpyF3I	CTNAG	1 cut(s)	73
HpySE526I	ACGT	1 cut(s)	351
Hsp92II	CATG	6 cut(s)	107, 113, 154, 218, 308, 368
Kpn2I	TCCGGA	1 cut(s)	79
Ksp22I	TGATCA	4 cut(s)	208, 265, 307, 385
Kzo9I	GATC	4 cut(s)	208, 265, 307, 385
LpnPI	CCDG	4 cut(s)	76, 93, 282, 333
Lsp1109I	GCAGC	5 cut(s)	4, 56, 267, 347, 364
MaeI	CTAG	3 cut(s)	141, 168, 198
MaeII	ACGT	1 cut(s)	351
MaeIII	GTNAC	1 cut(s)	352
MalI	GATC	4 cut(s)	210, 267, 309, 387
MboI	GATC	4 cut(s)	208, 265, 307, 385
MfeI	CAATTG	1 cut(s)	314
MluCI	AATT	4 cut(s)	25, 37, 314, 389
MnlI	CCTC	3 cut(s)	4, 286, 352
MroI	TCCGGA	1 cut(s)	79
MseI	TTAA	2 cut(s)	24, 137
MslI	CAYNNNNRTG	1 cut(s)	108
MspI	CCGG	1 cut(s)	80
MunI	CAATTG	1 cut(s)	314
MwoI	GCNNNNNNNGC	1 cut(s)	344
NdeII	GATC	4 cut(s)	208, 265, 307, 385
NlaIII	CATG	6 cut(s)	107, 113, 154, 218, 308, 368
NmeAIII	GCCGAG	1 cut(s)	323
NmuCI	GTSAC	1 cut(s)	352
PagI	TCATGA	3 cut(s)	214, 304, 364
PfeI	GAWTC	2 cut(s)	157, 218
PkrI	GCNGC	6 cut(s)	16, 19, 71, 282, 337, 379
PsiI	TTATAA	1 cut(s)	33
PspPI	GGNCC	1 cut(s)	82
PstI	CTGCAG	2 cut(s)	22, 285
PstNI	CAGNNNCTG	1 cut(s)	69
RsaI	GTAC	2 cut(s)	184, 259
RsaNI	GTAC	2 cut(s)	183, 258
RseI	CAYNNNNRTG	1 cut(s)	108
SaqAI	TTAA	2 cut(s)	24, 137
SatI	GCNGC	6 cut(s)	15, 18, 70, 281, 336, 378
Sau3AI	GATC	4 cut(s)	208, 265, 307, 385
Sau96I	GGNCC	1 cut(s)	82
ScaI	AGTACT	1 cut(s)	259
SetI	ASST	6 cut(s)	71, 93, 184, 282, 344, 354
SfcI	CTRYAG	2 cut(s)	18, 281
SinI	GGWCC	1 cut(s)	82
SmiMI	CAYNNNNRTG	1 cut(s)	108
SpeI	ACTAGT	2 cut(s)	140, 197
Sse9I	AATT	4 cut(s)	25, 37, 314, 389
SspMI	CTAG	3 cut(s)	141, 168, 198
StyI	CCWWGG	1 cut(s)	178
TaiI	ACGT	1 cut(s)	354
TasI	AATT	4 cut(s)	25, 37, 314, 389
TatI	WGTACW	1 cut(s)	257
TfiI	GAWTC	2 cut(s)	157, 218
Tru1I	TTAA	2 cut(s)	24, 137
Tru9I	TTAA	2 cut(s)	24, 137
TseFI	GTSAC	1 cut(s)	352
TseI	GCWGC	6 cut(s)	14, 17, 69, 280, 335, 377
Tsp45I	GTSAC	1 cut(s)	352
TspDTI	ATGAA	2 cut(s)	170, 257
VpaK11BI	GGWCC	1 cut(s)	82
XspI	CTAG	3 cut(s)	141, 168, 198
ZrmI	AGTACT	1 cut(s)	259

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.