Rmu_co8033688.1_g000001

cation-transporting ATPase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8033688.1
Physical Location & Seq
Reverse (-)
1 .. 334
334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8033688.1_g000001.1.cds

Sequence Viewer

Length: 249 bp
atgtcgaggttcaatgtgggagggaaggtggtggacaaggttgatttgttgaggaagaagaagttggcgtggcgcttcgatgtgtggcctttcggtatcctctatgctctgtggctcactacagttgtgcctagtttagactttggcgacgccattattgttctcggtggtgtagtggcgcttcacattctcgtttggcttttcactgcttggtccgtcgacttcaattgctttgtacactattccaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.5

Weight (kDa)

9.3

Isoelectric Point (pI)

39.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 219
AcyI GRCGYC 1 cut(s) 150
AfaI GTAC 1 cut(s) 237
AgsI TTSAA 2 cut(s) 13, 226
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AoxI GGCC 1 cut(s) 86
AspLEI GCGC 2 cut(s) 75, 181
AspS9I GGNCC 1 cut(s) 213
AvaII GGWCC 1 cut(s) 213
BarI GAAGNNNNNNTAC 2 cut(s) 165, 197
BciVI GTATCC 1 cut(s) 107
BfaI CTAG 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 120
BfoI RGCGCY 2 cut(s) 76, 182
BfuI GTATCC 1 cut(s) 107
Bme18I GGWCC 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 213
BsaHI GRCGYC 1 cut(s) 150
BsaXI ACNNNNNCTCC 2 cut(s) 12, 42
BshFI GGCC 1 cut(s) 88
BsnI GGCC 1 cut(s) 88
Bsp1407I TGTACA 1 cut(s) 235
BspANI GGCC 1 cut(s) 88
BsrGI TGTACA 1 cut(s) 235
BssNI GRCGYC 1 cut(s) 150
Bst4CI ACNGT 1 cut(s) 124
BstACI GRCGYC 1 cut(s) 150
BstAUI TGTACA 1 cut(s) 235
BstH2I RGCGCY 2 cut(s) 76, 182
BstHHI GCGC 2 cut(s) 75, 181
BstSFI CTRYAG 1 cut(s) 120
BsuI GTATCC 1 cut(s) 107
BsuRI GGCC 1 cut(s) 88
BtsI GCAGTG 1 cut(s) 204
BtsIMutI CAGTG 1 cut(s) 204
CfoI GCGC 2 cut(s) 75, 181
Cfr13I GGNCC 1 cut(s) 213
CseI GACGC 1 cut(s) 158
Csp6I GTAC 1 cut(s) 236
CviJI RGCY 3 cut(s) 88, 115, 199
CviKI_1 RGCY 3 cut(s) 88, 115, 199
CviQI GTAC 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 213
FaiI YATR 1 cut(s) 105
FblI GTMKAC 1 cut(s) 219
FspBI CTAG 1 cut(s) 132
GlaI GCGC 2 cut(s) 74, 180
HaeII RGCGCY 2 cut(s) 76, 182
HaeIII GGCC 1 cut(s) 88
HgaI GACGC 1 cut(s) 158
HhaI GCGC 2 cut(s) 75, 181
Hin1I GRCGYC 1 cut(s) 150
Hin6I GCGC 2 cut(s) 73, 179
HinP1I GCGC 2 cut(s) 73, 179
HincII GTYRAC 1 cut(s) 220
HindII GTYRAC 1 cut(s) 220
Hpy166II GTNNAC 3 cut(s) 34, 220, 238
Hpy8I GTNNAC 3 cut(s) 34, 220, 238
Hpy99I CGWCG 2 cut(s) 152, 221
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 124
Hsp92I GRCGYC 1 cut(s) 150
HspAI GCGC 2 cut(s) 73, 179
MaeI CTAG 1 cut(s) 132
MboII GAAGA 2 cut(s) 67, 70
MfeI CAATTG 1 cut(s) 226
MluCI AATT 1 cut(s) 226
MnlI CCTC 3 cut(s) 14, 45, 110
MunI CAATTG 1 cut(s) 226
PspPI GGNCC 1 cut(s) 213
RsaI GTAC 1 cut(s) 237
RsaNI GTAC 1 cut(s) 236
SalI GTCGAC 1 cut(s) 218
Sau96I GGNCC 1 cut(s) 213
SetI ASST 3 cut(s) 11, 30, 42
SfcI CTRYAG 1 cut(s) 120
SgeI CNNG 7 cut(s) 18, 49, 81, 144, 176, 203, 222
SinI GGWCC 1 cut(s) 213
Sse9I AATT 1 cut(s) 226
SspMI CTAG 1 cut(s) 132
TaaI ACNGT 1 cut(s) 124
TaqI TCGA 3 cut(s) 5, 78, 219
TasI AATT 1 cut(s) 226
TatI WGTACW 1 cut(s) 235
TscAI CASTG 1 cut(s) 211
TspGWI ACGGA 1 cut(s) 205
TspRI CASTG 1 cut(s) 211
VpaK11BI GGWCC 1 cut(s) 213
XmiI GTMKAC 1 cut(s) 219
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.