Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8045566.1

Orthogroup ID

OG0004166

Physical Location & Seq

Genomic Coordinates Reverse (-)

19 .. 538

Gene Structure 520 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8045566.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ctgtcaaaacctggagatctcatcaatttgtttcttcaggtggcattccgtgcaaagattgggaaaagatatcagcttcctcataaagggatcataccagaagaatttggagtggttgctcgatataaaggacaggggaggcttgctgagccagggtttcgtaatcctcgatgggtcgatggtgaacttgttattcttgatggaaagtacattaaaggaggacctgttgttgggtttgtttattgggccccagagtatcatttcttggtgttctttaatcgactgaggcttcaaggctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000302 GO:0000304 GO:0005575 GO:0005622 GO:0005623 GO:0006950 GO:0006979 GO:0007154 GO:0007584 GO:0008150 GO:0008219 GO:0009579 GO:0009605 GO:0009987 GO:0009991 GO:0010035 GO:0010343 GO:0012501 GO:0016020 GO:0031667 GO:0031668 GO:0031669 GO:0031670 GO:0033554 GO:0034357 GO:0034599 GO:0034614 GO:0035690 GO:0036473 GO:0042221 GO:0042493 GO:0042651 GO:0044424 GO:0044436 GO:0044464 GO:0050896 GO:0051716 GO:0070887 GO:0071452 GO:0071496 GO:0097468 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3506 UVR

Protein Analysis

99

Amino Acids

11.33

Weight (kDa)

9.99

Isoelectric Point (pI)

30.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004166)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33630 AT4G33630 AT4G33630
fragaria_vesca	FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660 FvH4_2g11660
malus_domestica	MD05G1048100.v1.1 MD10G1054700.v1.1
prunus_persica	Prupe.8G070300_v2.0.a1 Prupe.8G070300_v2.0.a1
pyrus_communis	pycom10g04160 pycom10g04170
rosa_chinensis	RchiOBHm_Chr6g0270901 RchiOBHm_Chr6g0270911
rosa_laevigata	RLG00000013760
rosa_multiflora	Rmu_co8045566.1_g000001 Rmu_sc0007274.1_g000002 Rmu_ssc0000474.1_g000011
rosa_roxburghii	Rroxscaffold_7G00197500
rosa_rugosa	Rorug06G0057200
rosa_samantha	Rh6AG176700 Rh6BG180100 Rh6CG176200 Rh6DG168400
rosa_wichuraiana	Rw6G015060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	98
AcsI	RAATTY	1 cut(s)	104
AcuI	CTGAAG	1 cut(s)	20
AfaI	GTAC	1 cut(s)	209
AfiI	CCNNNNNNNGG	2 cut(s)	86, 230
AgsI	TTSAA	1 cut(s)	293
AjnI	CCWGG	2 cut(s)	10, 151
AluBI	AGCT	1 cut(s)	76
AluI	AGCT	1 cut(s)	76
AlwI	GGATC	1 cut(s)	98
AoxI	GGCC	1 cut(s)	246
ApaI	GGGCCC	1 cut(s)	250
ApoI	RAATTY	1 cut(s)	104
AspS9I	GGNCC	3 cut(s)	221, 246, 247
AsuHPI	GGTGA	1 cut(s)	194
AvaII	GGWCC	1 cut(s)	221
BaeGI	GKGCMC	1 cut(s)	250
BanII	GRGCYC	1 cut(s)	250
BccI	CCATC	3 cut(s)	165, 173, 194
BciT130I	CCWGG	2 cut(s)	12, 153
BfaI	CTAG	1 cut(s)	298
BglII	AGATCT	1 cut(s)	16
BlpI	GCTNAGC	1 cut(s)	147
Bme1390I	CCNGG	2 cut(s)	12, 153
Bme18I	GGWCC	1 cut(s)	221
BmgT120I	GGNCC	3 cut(s)	221, 246, 247
BmiI	GGNNCC	2 cut(s)	248, 249
BmrFI	CCNGG	2 cut(s)	12, 153
BpmI	CTGGAG	1 cut(s)	33
Bpu1102I	GCTNAGC	1 cut(s)	147
BsaJI	CCNNGG	1 cut(s)	152
BsaXI	ACNNNNNCTCC	2 cut(s)	210, 240
Bsc4I	CCNNNNNNNGG	2 cut(s)	86, 230
BseBI	CCWGG	2 cut(s)	12, 153
BseDI	CCNNGG	1 cut(s)	152
BseLI	CCNNNNNNNGG	2 cut(s)	86, 230
BseMII	CTCAG	2 cut(s)	138, 275
BseSI	GKGCMC	1 cut(s)	250
BshFI	GGCC	1 cut(s)	248
BslI	CCNNNNNNNGG	2 cut(s)	86, 230
BsmI	GAATGC	1 cut(s)	44
BsnI	GGCC	1 cut(s)	248
Bsp120I	GGGCCC	1 cut(s)	246
Bsp1286I	GDGCHC	1 cut(s)	250
Bsp143I	GATC	2 cut(s)	16, 90
Bsp1720I	GCTNAGC	1 cut(s)	147
BspANI	GGCC	1 cut(s)	248
BspCNI	CTCAG	2 cut(s)	139, 276
BspLI	GGNNCC	2 cut(s)	248, 249
BspPI	GGATC	1 cut(s)	98
BssECI	CCNNGG	1 cut(s)	152
BssMI	GATC	2 cut(s)	16, 90
Bst2UI	CCWGG	2 cut(s)	12, 153
BstAPI	GCANNNNNTGC	1 cut(s)	50
BstC8I	GCNNGC	1 cut(s)	144
BstDEI	CTNAG	2 cut(s)	147, 284
BstENI	CCTNNNNNAGG	1 cut(s)	84
BstKTI	GATC	2 cut(s)	19, 93
BstMBI	GATC	2 cut(s)	16, 90
BstMWI	GCNNNNNNNGC	2 cut(s)	50, 148
BstNI	CCWGG	2 cut(s)	12, 153
BstSCI	CCNGG	2 cut(s)	10, 151
BstSLI	GKGCMC	1 cut(s)	250
BstX2I	RGATCY	1 cut(s)	16
BstYI	RGATCY	1 cut(s)	16
BsuRI	GGCC	1 cut(s)	248
Cac8I	GCNNGC	1 cut(s)	144
Cfr13I	GGNCC	3 cut(s)	221, 246, 247
Csp6I	GTAC	1 cut(s)	208
CviJI	RGCY	6 cut(s)	76, 142, 151, 248, 289, 297
CviKI_1	RGCY	6 cut(s)	76, 142, 151, 248, 289, 297
CviQI	GTAC	1 cut(s)	208
DdeI	CTNAG	2 cut(s)	147, 284
DpnI	GATC	2 cut(s)	18, 92
DpnII	GATC	2 cut(s)	16, 90
Eco24I	GRGCYC	1 cut(s)	250
Eco32I	GATATC	1 cut(s)	71
Eco47I	GGWCC	1 cut(s)	221
Eco57I	CTGAAG	1 cut(s)	20
EcoNI	CCTNNNNNAGG	1 cut(s)	84
EcoO109I	RGGNCCY	2 cut(s)	221, 247
EcoRII	CCWGG	2 cut(s)	10, 151
EcoRV	GATATC	1 cut(s)	71
EcoT38I	GRGCYC	1 cut(s)	250
FaiI	YATR	3 cut(s)	84, 95, 126
FriOI	GRGCYC	1 cut(s)	250
FspBI	CTAG	1 cut(s)	298
GsuI	CTGGAG	1 cut(s)	33
HaeIII	GGCC	1 cut(s)	248
HphI	GGTGA	1 cut(s)	194
Hpy166II	GTNNAC	1 cut(s)	185
Hpy188III	TCNNGA	1 cut(s)	197
Hpy8I	GTNNAC	1 cut(s)	185
HpyCH4V	TGCA	1 cut(s)	53
HpyF10VI	GCNNNNNNNGC	2 cut(s)	50, 148
HpyF3I	CTNAG	2 cut(s)	147, 284
Kzo9I	GATC	2 cut(s)	16, 90
LpnPI	CCDG	8 cut(s)	23, 24, 111, 119, 138, 165, 237, 264
MaeI	CTAG	1 cut(s)	298
MalI	GATC	2 cut(s)	18, 92
MboI	GATC	2 cut(s)	16, 90
MboII	GAAGA	2 cut(s)	26, 113
MflI	RGATCY	1 cut(s)	16
MhlI	GDGCHC	1 cut(s)	250
MluCI	AATT	2 cut(s)	25, 104
MnlI	CCTC	5 cut(s)	90, 132, 177, 212, 279
MseI	TTAA	2 cut(s)	213, 276
MspR9I	CCNGG	2 cut(s)	12, 153
Mva1269I	GAATGC	1 cut(s)	44
MvaI	CCWGG	2 cut(s)	12, 153
MwoI	GCNNNNNNNGC	2 cut(s)	50, 148
NdeII	GATC	2 cut(s)	16, 90
NlaIV	GGNNCC	2 cut(s)	248, 249
PcsI	WCGNNNNNNNCGW	1 cut(s)	166
PctI	GAATGC	1 cut(s)	44
PpuMI	RGGWCCY	1 cut(s)	221
Psp5II	RGGWCCY	1 cut(s)	221
Psp6I	CCWGG	2 cut(s)	10, 151
PspGI	CCWGG	2 cut(s)	10, 151
PspN4I	GGNNCC	2 cut(s)	248, 249
PspOMI	GGGCCC	1 cut(s)	246
PspPI	GGNCC	3 cut(s)	221, 246, 247
PspPPI	RGGWCCY	1 cut(s)	221
PsuI	RGATCY	1 cut(s)	16
RsaI	GTAC	1 cut(s)	209
RsaNI	GTAC	1 cut(s)	208
SaqAI	TTAA	2 cut(s)	213, 276
Sau3AI	GATC	2 cut(s)	16, 90
Sau96I	GGNCC	3 cut(s)	221, 246, 247
ScrFI	CCNGG	2 cut(s)	12, 153
SduI	GDGCHC	1 cut(s)	250
SetI	ASST	4 cut(s)	13, 42, 78, 226
SinI	GGWCC	1 cut(s)	221
Sse9I	AATT	2 cut(s)	25, 104
SspMI	CTAG	1 cut(s)	298
StyD4I	CCNGG	2 cut(s)	10, 151
TaqI	TCGA	4 cut(s)	121, 169, 177, 280
TasI	AATT	2 cut(s)	25, 104
TatI	WGTACW	1 cut(s)	207
Tru1I	TTAA	2 cut(s)	213, 276
Tru9I	TTAA	2 cut(s)	213, 276
TspGWI	ACGGA	1 cut(s)	38
VpaK11BI	GGWCC	1 cut(s)	221
XagI	CCTNNNNNAGG	1 cut(s)	84
XapI	RAATTY	1 cut(s)	104
XspI	CTAG	1 cut(s)	298

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.