Rmu_co8056702.1_g000001

Enoyl-(Acyl carrier protein) reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8056702.1
Physical Location & Seq
Forward (+)
1 .. 420
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8056702.1_g000001.1.cds

Sequence Viewer

Length: 171 bp
gttaaacagttgttggagaaggaaaaaggtcatgttattgctagttgccgcaatcctaatggggcaacaggtcttctccatctgcaaagtaaatttgctgaacgccttactgttctacaattagatgtgacgaatgaaagcaccatacaggttccttttcttgatctctga

Protein Analysis

56

Amino Acids

6.21

Weight (kDa)

6.9

Isoelectric Point (pI)

38.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 92
ApoI RAATTY 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 65
BccI CCATC 1 cut(s) 87
BfaI CTAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 49
BlsI GCNGC 1 cut(s) 50
BmiI GGNNCC 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 163
BspACI CCGC 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 153
BssMI GATC 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 9, 112
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstV2I GAAGAC 1 cut(s) 65
CviAII CATG 1 cut(s) 32
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
FaeI CATG 1 cut(s) 35
FaiI YATR 2 cut(s) 33, 146
FatI CATG 1 cut(s) 31
Fnu4HI GCNGC 1 cut(s) 49
Fsp4HI GCNGC 1 cut(s) 49
FspBI CTAG 1 cut(s) 42
GluI GCNGC 1 cut(s) 49
Hin1II CATG 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 170
Hpy188III TCNNGA 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 13
HpyCH4III ACNGT 2 cut(s) 9, 112
HpyCH4V TGCA 1 cut(s) 85
Hsp92II CATG 1 cut(s) 35
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 2 cut(s) 54, 134
MaeI CTAG 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 127
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 1 cut(s) 65
MluCI AATT 2 cut(s) 92, 119
MseI TTAA 1 cut(s) 3
NdeII GATC 1 cut(s) 163
NlaIII CATG 1 cut(s) 35
NlaIV GGNNCC 1 cut(s) 153
NmuCI GTSAC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 50
PspN4I GGNNCC 1 cut(s) 153
SaqAI TTAA 1 cut(s) 3
SatI GCNGC 1 cut(s) 49
Sau3AI GATC 1 cut(s) 163
SetI ASST 3 cut(s) 31, 73, 153
SgeI CNNG 4 cut(s) 44, 54, 81, 161
Sse9I AATT 2 cut(s) 92, 119
SsiI CCGC 1 cut(s) 49
SspMI CTAG 1 cut(s) 42
TaaI ACNGT 2 cut(s) 9, 112
TasI AATT 2 cut(s) 92, 119
TauI GCSGC 1 cut(s) 51
Tru1I TTAA 1 cut(s) 3
Tru9I TTAA 1 cut(s) 3
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 150
XapI RAATTY 1 cut(s) 92
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.