Rmu_co8061150.1_g000001

LRR receptor-like serine threonine-protein kinase FEI

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8061150.1
Physical Location & Seq
Reverse (-)
2 .. 511
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8061150.1_g000001.1.cds

Sequence Viewer

Length: 409 bp
atgtgtttctggggttgctttctgtataagaagtttggtaaacttgacggtaaaggtcttgcaatggatgtcagagaaggtgcatcaattgttatgtttcatggagatttgccatactcttctaaagacattattaagaaattagagactttgaatgaggaacacataattggtgttgggggttttggaacagtgtacaagcttgcaatggatgatggcaatctatttgcactaaaaagaattgtaaagatgaacgagggctttgatcgtttttttgaaagggagctagaaattcttggaagtataaagcatcgctacttagtgaatttgaggggatactgcaattctcctacatcaaagttgttgatctatgattttctatctggtggaagcctcgatgaagctcttc

Protein Analysis

136

Amino Acids

15.39

Weight (kDa)

6.82

Isoelectric Point (pI)

19.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 291, 325
AfaI GTAC 1 cut(s) 197
AgsI TTSAA 2 cut(s) 154, 278
AjuI GAANNNNNNNTTGG 2 cut(s) 153, 185
AluBI AGCT 3 cut(s) 202, 286, 404
AluI AGCT 3 cut(s) 202, 286, 404
Alw26I GTCTC 1 cut(s) 140
ApoI RAATTY 2 cut(s) 291, 325
Asp700I GAANNNNTTC 1 cut(s) 405
BccI CCATC 1 cut(s) 209
BciVI GTATCC 1 cut(s) 329
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 1 cut(s) 287
BfuI GTATCC 1 cut(s) 329
BmsI GCATC 2 cut(s) 92, 319
BsaBI GATNNNNATC 1 cut(s) 219
Bse3DI GCAATG 2 cut(s) 69, 213
Bse8I GATNNNNATC 1 cut(s) 219
BseGI GGATG 2 cut(s) 73, 217
BseJI GATNNNNATC 1 cut(s) 219
BseMI GCAATG 2 cut(s) 69, 213
BsmAI GTCTC 1 cut(s) 140
Bsp1407I TGTACA 1 cut(s) 195
Bsp143I GATC 2 cut(s) 265, 366
BsrDI GCAATG 2 cut(s) 69, 213
BsrGI TGTACA 1 cut(s) 195
BssMI GATC 2 cut(s) 265, 366
Bst4CI ACNGT 2 cut(s) 50, 193
Bst6I CTCTTC 1 cut(s) 124
BstAUI TGTACA 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 204
BstDEI CTNAG 1 cut(s) 319
BstF5I GGATG 2 cut(s) 73, 217
BstKTI GATC 2 cut(s) 268, 369
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 2 cut(s) 265, 366
BsuI GTATCC 1 cut(s) 329
BtgZI GCGATG 1 cut(s) 296
BtsCI GGATG 2 cut(s) 73, 217
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 196
CviAII CATG 1 cut(s) 101
CviJI RGCY 5 cut(s) 202, 261, 286, 393, 404
CviKI_1 RGCY 5 cut(s) 202, 261, 286, 393, 404
CviQI GTAC 1 cut(s) 196
DdeI CTNAG 1 cut(s) 319
DpnI GATC 2 cut(s) 267, 368
DpnII GATC 2 cut(s) 265, 366
Eam1104I CTCTTC 1 cut(s) 124
EarI CTCTTC 1 cut(s) 124
FaeI CATG 1 cut(s) 104
FaiI YATR 7 cut(s) 27, 95, 102, 115, 167, 305, 372
FatI CATG 1 cut(s) 100
FokI GGATG 2 cut(s) 80, 224
FspBI CTAG 1 cut(s) 287
Hin1II CATG 1 cut(s) 104
HindIII AAGCTT 1 cut(s) 200
Hpy166II GTNNAC 2 cut(s) 41, 196
Hpy188I TCNGA 1 cut(s) 74
Hpy8I GTNNAC 2 cut(s) 41, 196
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 2 cut(s) 50, 193
HpyCH4V TGCA 5 cut(s) 62, 83, 206, 230, 342
HpyF3I CTNAG 1 cut(s) 319
Hsp92II CATG 1 cut(s) 104
Kzo9I GATC 2 cut(s) 265, 366
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 1 cut(s) 369
LweI GCATC 2 cut(s) 92, 319
MaeI CTAG 1 cut(s) 287
MalI GATC 2 cut(s) 267, 368
MboI GATC 2 cut(s) 265, 366
MboII GAAGA 2 cut(s) 111, 398
MfeI CAATTG 1 cut(s) 87
MluCI AATT 7 cut(s) 87, 140, 168, 240, 291, 325, 343
MnlI CCTC 4 cut(s) 151, 250, 324, 404
MroXI GAANNNNTTC 1 cut(s) 405
MseI TTAA 1 cut(s) 135
MunI CAATTG 1 cut(s) 87
NdeII GATC 2 cut(s) 265, 366
NlaIII CATG 1 cut(s) 104
PdmI GAANNNNTTC 1 cut(s) 405
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 2 cut(s) 265, 366
SetI ASST 5 cut(s) 58, 82, 204, 288, 406
SfaNI GCATC 2 cut(s) 92, 319
Sse9I AATT 7 cut(s) 87, 140, 168, 240, 291, 325, 343
SspMI CTAG 1 cut(s) 287
TaaI ACNGT 2 cut(s) 50, 193
TaqI TCGA 1 cut(s) 396
TasI AATT 7 cut(s) 87, 140, 168, 240, 291, 325, 343
TatI WGTACW 1 cut(s) 195
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 198
TspDTI ATGAA 2 cut(s) 89, 266
TspRI CASTG 1 cut(s) 198
XapI RAATTY 2 cut(s) 291, 325
XmnI GAANNNNTTC 1 cut(s) 405
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.