Rmu_co8071018.1_g000001

COBW domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8071018.1
Physical Location & Seq
Forward (+)
1 .. 576
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8071018.1_g000001.1.cds

Sequence Viewer

Length: 379 bp
ctctcacaaaaatggaggacgaagaagaaactccacctctcgccgttgaaatcgaccaacccttttcaagtggacccgatgacgtcgacgctcccgtcggcgtcaccgtcgtcactggttatctgggttcaggcaaatccactctggttaatcatatattaaacacccaacatgggaagaaaattgctgtgatattaaacgagtttggtgaggaaattggggttgagagggcaatgataaacgaaggagatggtggtgctcttgtggaagagtgggttgagttggcaaatgggtgtatatgttgcactgtgaagcacagtttggtgcaagcactagagcaacttgtgcagagaaaagaaaggtttgaggtttataatgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.67

Weight (kDa)

4.43

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011931)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 374
AasI GACNNNNNNGTC 1 cut(s) 94
AatII GACGTC 1 cut(s) 86
AccI GTMKAC 1 cut(s) 86
AcyI GRCGYC 2 cut(s) 83, 101
AfiI CCNNNNNNNGG 1 cut(s) 173
AgsI TTSAA 2 cut(s) 49, 68
AjuI GAANNNNNNNTTGG 2 cut(s) 304, 336
Alw21I GWGCWC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 73
AsuHPI GGTGA 2 cut(s) 96, 220
AvaII GGWCC 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 261
BccI CCATC 1 cut(s) 244
BceAI ACGGC 1 cut(s) 28
BfaI CTAG 1 cut(s) 334
Bme18I GGWCC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 73
BmiI GGNNCC 1 cut(s) 75
BsaHI GRCGYC 2 cut(s) 83, 101
Bsc4I CCNNNNNNNGG 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 120
Bse3DI GCAATG 1 cut(s) 239
BseLI CCNNNNNNNGG 1 cut(s) 173
BseMI GCAATG 1 cut(s) 239
BseNI ACTGG 1 cut(s) 120
BsgI GTGCAG 1 cut(s) 367
BsiHKAI GWGCWC 1 cut(s) 261
BslI CCNNNNNNNGG 1 cut(s) 173
Bsp1286I GDGCHC 1 cut(s) 261
BspLI GGNNCC 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 239
BsrI ACTGG 1 cut(s) 120
BssNI GRCGYC 2 cut(s) 83, 101
Bst4CI ACNGT 3 cut(s) 108, 309, 319
Bst6I CTCTTC 1 cut(s) 263
BstACI GRCGYC 2 cut(s) 83, 101
BstAPI GCANNNNNTGC 1 cut(s) 345
BstC8I GCNNGC 1 cut(s) 329
BstMWI GCNNNNNNNGC 1 cut(s) 345
BtsIMutI CAGTG 2 cut(s) 113, 305
Cac8I GCNNGC 1 cut(s) 329
Cfr13I GGNCC 1 cut(s) 73
CseI GACGC 2 cut(s) 90, 97
CviAII CATG 1 cut(s) 172
DrdI GACNNNNNNGTC 1 cut(s) 94
DseDI GACNNNNNNGTC 1 cut(s) 94
Eam1104I CTCTTC 1 cut(s) 263
EarI CTCTTC 1 cut(s) 263
Eco47I GGWCC 1 cut(s) 73
FaeI CATG 1 cut(s) 175
FaiI YATR 6 cut(s) 155, 157, 173, 298, 300, 374
FatI CATG 1 cut(s) 171
FblI GTMKAC 1 cut(s) 86
FspBI CTAG 1 cut(s) 334
HgaI GACGC 2 cut(s) 90, 97
Hin1I GRCGYC 2 cut(s) 83, 101
Hin1II CATG 1 cut(s) 175
HincII GTYRAC 1 cut(s) 87
HindII GTYRAC 1 cut(s) 87
HphI GGTGA 2 cut(s) 96, 220
Hpy166II GTNNAC 2 cut(s) 73, 87
Hpy8I GTNNAC 2 cut(s) 73, 87
Hpy99I CGWCG 4 cut(s) 88, 91, 100, 112
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 3 cut(s) 108, 309, 319
HpyCH4IV ACGT 1 cut(s) 83
HpyCH4V TGCA 3 cut(s) 305, 327, 348
HpyF10VI GCNNNNNNNGC 1 cut(s) 345
HpySE526I ACGT 1 cut(s) 83
Hsp92I GRCGYC 2 cut(s) 83, 101
Hsp92II CATG 1 cut(s) 175
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 4 cut(s) 101, 109, 116, 130
MaeI CTAG 1 cut(s) 334
MaeII ACGT 1 cut(s) 83
MaeIII GTNAC 2 cut(s) 102, 111
MboII GAAGA 4 cut(s) 34, 37, 189, 280
MhlI GDGCHC 1 cut(s) 261
MluCI AATT 2 cut(s) 182, 215
MnlI CCTC 5 cut(s) 9, 47, 204, 221, 360
MseI TTAA 3 cut(s) 149, 160, 196
MslI CAYNNNNRTG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 345
NlaIII CATG 1 cut(s) 175
NlaIV GGNNCC 1 cut(s) 75
NmuCI GTSAC 2 cut(s) 102, 111
PcsI WCGNNNNNNNCGW 2 cut(s) 92, 104
PsiI TTATAA 1 cut(s) 374
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 10
SalI GTCGAC 1 cut(s) 85
SaqAI TTAA 3 cut(s) 149, 160, 196
Sau96I GGNCC 1 cut(s) 73
SduI GDGCHC 1 cut(s) 261
SetI ASST 4 cut(s) 39, 86, 364, 371
SgrDI CGTCGACG 1 cut(s) 85
SinI GGWCC 1 cut(s) 73
SmiMI CAYNNNNRTG 1 cut(s) 10
Sse9I AATT 2 cut(s) 182, 215
SspMI CTAG 1 cut(s) 334
TaaI ACNGT 3 cut(s) 108, 309, 319
TaiI ACGT 1 cut(s) 86
TaqI TCGA 2 cut(s) 53, 86
TasI AATT 2 cut(s) 182, 215
Tru1I TTAA 3 cut(s) 149, 160, 196
Tru9I TTAA 3 cut(s) 149, 160, 196
TscAI CASTG 2 cut(s) 120, 312
TseFI GTSAC 2 cut(s) 102, 111
Tsp45I GTSAC 2 cut(s) 102, 111
TspRI CASTG 2 cut(s) 120, 312
VpaK11BI GGWCC 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 86
XspI CTAG 1 cut(s) 334
ZraI GACGTC 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.