Rmu_co8096142.1_g000001

Ankyrin repeats (many copies)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8096142.1
Physical Location & Seq
Forward (+)
1 .. 578
578 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8096142.1_g000001.1.cds

Sequence Viewer

Length: 537 bp
attaaggatgcagagggaggaattctttttgtagatgaagcttatcgactgatacctatgcagaaggcagatgataaagactatggtttggaagcattggaagaaatcatgtctgtcatggacagtggaaagatcgtagtcatatttgctggatatagtgaaccaatgaaacgtgtaattgcttcgaatgaaggtttctgcagacgtgtgaccaagtttttcaactttagtgacttcagtcctgaagatctagcaaagattcttcatctcaagatgaataatcaaacagaggagagcatgttgtatggatttaagctacattctttttgcagtttagaagccattgcagaactgattcaaagaggagcaacagaaaagcagtgtaaggagatgaatggaggtttagttgatacaatgttagttaatgccagagagaatttggaccttaggctcaattttgattgtatagacacagaagaacttagaacaatcaccttagaggatttacaagcaggccttcagattttgtcacaatga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

178

Amino Acids

20.16

Weight (kDa)

4.62

Isoelectric Point (pI)

34.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011301)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 21, 436
AcuI CTGAAG 3 cut(s) 220, 264, 503
AflIII ACRYGT 2 cut(s) 172, 205
AgsI TTSAA 2 cut(s) 223, 359
AjiI CACGTC 1 cut(s) 206
AluBI AGCT 2 cut(s) 41, 316
AluI AGCT 2 cut(s) 41, 316
AoxI GGCC 1 cut(s) 514
ApoI RAATTY 2 cut(s) 21, 436
Asp700I GAANNNNTTC 1 cut(s) 354
AspS9I GGNCC 1 cut(s) 442
AsuHPI GGTGA 1 cut(s) 484
AsuII TTCGAA 1 cut(s) 185
AvaII GGWCC 1 cut(s) 442
AxyI CCTNAGG 1 cut(s) 446
BfaI CTAG 1 cut(s) 251
BfmI CTRYAG 1 cut(s) 199
BglII AGATCT 1 cut(s) 247
Bme18I GGWCC 1 cut(s) 442
BmgBI CACGTC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 442
BoxI GACNNNNGTC 1 cut(s) 237
Bpu14I TTCGAA 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 254
BsaXI ACNNNNNCTCC 4 cut(s) 284, 314, 390, 420
Bse21I CCTNAGG 1 cut(s) 446
Bse3DI GCAATG 1 cut(s) 342
BseGI GGATG 1 cut(s) 13
BseMI GCAATG 1 cut(s) 342
BseRI GAGGAG 2 cut(s) 305, 378
BshFI GGCC 1 cut(s) 516
BsnI GGCC 1 cut(s) 516
Bsp119I TTCGAA 1 cut(s) 185
Bsp143I GATC 2 cut(s) 132, 247
BspANI GGCC 1 cut(s) 516
BspMAI CTGCAG 1 cut(s) 203
BspT104I TTCGAA 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 342
BssMI GATC 2 cut(s) 132, 247
Bst4CI ACNGT 1 cut(s) 125
BstBI TTCGAA 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 514
BstDEI CTNAG 3 cut(s) 446, 482, 496
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 2 cut(s) 135, 250
BstMBI GATC 2 cut(s) 132, 247
BstNSI RCATGY 1 cut(s) 301
BstPAI GACNNNNGTC 1 cut(s) 237
BstSFI CTRYAG 1 cut(s) 199
BstX2I RGATCY 1 cut(s) 247
BstYI RGATCY 1 cut(s) 247
Bsu36I CCTNAGG 1 cut(s) 446
BsuRI GGCC 1 cut(s) 516
BtrI CACGTC 1 cut(s) 206
BtsCI GGATG 1 cut(s) 13
BtsI GCAGTG 1 cut(s) 386
BtsIMutI CAGTG 2 cut(s) 130, 386
Cac8I GCNNGC 1 cut(s) 514
Cfr13I GGNCC 1 cut(s) 442
CviAII CATG 3 cut(s) 109, 118, 298
CviJI RGCY 5 cut(s) 41, 316, 341, 451, 516
CviKI_1 RGCY 5 cut(s) 41, 316, 341, 451, 516
DdeI CTNAG 3 cut(s) 446, 482, 496
DpnI GATC 2 cut(s) 134, 249
DpnII GATC 2 cut(s) 132, 247
Eco147I AGGCCT 1 cut(s) 516
Eco47I GGWCC 1 cut(s) 442
Eco57I CTGAAG 3 cut(s) 220, 264, 503
Eco81I CCTNAGG 1 cut(s) 446
EcoRI GAATTC 1 cut(s) 21
FaeI CATG 3 cut(s) 112, 121, 301
FaiI YATR 9 cut(s) 59, 84, 110, 119, 143, 156, 299, 306, 467
FalI AAGNNNNNCTT 2 cut(s) 501, 533
FatI CATG 3 cut(s) 108, 117, 297
FokI GGATG 1 cut(s) 20
FspBI CTAG 1 cut(s) 251
HaeIII GGCC 1 cut(s) 516
Hin1II CATG 3 cut(s) 112, 121, 301
HindIII AAGCTT 1 cut(s) 39
HinfI GANTC 2 cut(s) 259, 355
HphI GGTGA 1 cut(s) 484
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 522
Hpy188III TCNNGA 2 cut(s) 242, 271
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 3 cut(s) 58, 185, 527
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4IV ACGT 2 cut(s) 172, 205
HpyCH4V TGCA 5 cut(s) 11, 61, 201, 330, 347
HpyF3I CTNAG 3 cut(s) 446, 482, 496
HpySE526I ACGT 2 cut(s) 172, 205
Hsp92II CATG 3 cut(s) 112, 121, 301
Kzo9I GATC 2 cut(s) 132, 247
LmnI GCTCC 1 cut(s) 365
LpnPI CCDG 4 cut(s) 135, 255, 442, 498
MaeI CTAG 1 cut(s) 251
MaeII ACGT 2 cut(s) 172, 205
MaeIII GTNAC 3 cut(s) 208, 230, 528
MalI GATC 2 cut(s) 134, 249
MboI GATC 2 cut(s) 132, 247
MboII GAAGA 4 cut(s) 113, 254, 257, 488
MflI RGATCY 1 cut(s) 247
MluCI AATT 4 cut(s) 21, 177, 436, 454
MnlI CCTC 6 cut(s) 7, 11, 283, 356, 392, 493
MroXI GAANNNNTTC 1 cut(s) 354
MseI TTAA 3 cut(s) 3, 312, 423
NdeII GATC 2 cut(s) 132, 247
NlaIII CATG 3 cut(s) 112, 121, 301
NmuCI GTSAC 3 cut(s) 208, 230, 528
NspI RCATGY 1 cut(s) 301
NspV TTCGAA 1 cut(s) 185
PceI AGGCCT 1 cut(s) 516
PdmI GAANNNNTTC 1 cut(s) 354
PfeI GAWTC 2 cut(s) 259, 355
PshAI GACNNNNGTC 1 cut(s) 237
PspPI GGNCC 1 cut(s) 442
PstI CTGCAG 1 cut(s) 203
PsuI RGATCY 1 cut(s) 247
SaqAI TTAA 3 cut(s) 3, 312, 423
Sau3AI GATC 2 cut(s) 132, 247
Sau96I GGNCC 1 cut(s) 442
SetI ASST 9 cut(s) 43, 58, 175, 196, 208, 318, 403, 447, 497
SfcI CTRYAG 1 cut(s) 199
SfuI TTCGAA 1 cut(s) 185
SinI GGWCC 1 cut(s) 442
SmlI CTYRAG 1 cut(s) 269
SmoI CTYRAG 1 cut(s) 269
Sse9I AATT 4 cut(s) 21, 177, 436, 454
SseBI AGGCCT 1 cut(s) 516
SspMI CTAG 1 cut(s) 251
StuI AGGCCT 1 cut(s) 516
TaaI ACNGT 1 cut(s) 125
TaiI ACGT 2 cut(s) 175, 208
TaqI TCGA 2 cut(s) 46, 185
TasI AATT 4 cut(s) 21, 177, 436, 454
TfiI GAWTC 2 cut(s) 259, 355
Tru1I TTAA 3 cut(s) 3, 312, 423
Tru9I TTAA 3 cut(s) 3, 312, 423
TscAI CASTG 2 cut(s) 130, 386
TseFI GTSAC 3 cut(s) 208, 230, 528
Tsp45I GTSAC 3 cut(s) 208, 230, 528
TspDTI ATGAA 6 cut(s) 51, 182, 204, 254, 290, 407
TspRI CASTG 2 cut(s) 130, 386
VpaK11BI GGWCC 1 cut(s) 442
XapI RAATTY 2 cut(s) 21, 436
XceI RCATGY 1 cut(s) 301
XcmI CCANNNNNNNNNTGG 1 cut(s) 436
XmnI GAANNNNTTC 1 cut(s) 354
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.