Rmu_co8122260.1_g000001

Protein of unknown function (DUF1218)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8122260.1
OG0009101
Physical Location & Seq
Reverse (-)
295 .. 555
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8122260.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgtactttggcagctactactgttatgttgtgaagcctggagtgtttgctggtggtgctgtcttatcccttgcaagtgtgaccctaggaattttctactacatcaccttaaattcagcaaagaacaacgacaatctgtgtggtaatgctgttcaggggccagcaatagcaatggggcaaccccagtttccagcgcagaataatactcaagaccctgtctttgtccatgaagacacttacatgagacggcaattcacatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1218

Protein Analysis

86

Amino Acids

9.45

Weight (kDa)

6.5

Isoelectric Point (pI)

41.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 90, 112
AfaI GTAC 1 cut(s) 5
AjnI CCWGG 1 cut(s) 37
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 238
AoxI GGCC 1 cut(s) 158
ApeKI GCWGC 1 cut(s) 12
ApoI RAATTY 2 cut(s) 90, 112
ArsI GACNNNNNNTTYG 2 cut(s) 203, 235
AspA2I CCTAGG 1 cut(s) 85
AspLEI GCGC 1 cut(s) 196
AspS9I GGNCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 97
AvrII CCTAGG 1 cut(s) 85
BbsI GAAGAC 1 cut(s) 237
BbvI GCAGC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 39
BcoDI GTCTC 1 cut(s) 238
BfaI CTAG 1 cut(s) 86
BisI GCNGC 1 cut(s) 13
BlnI CCTAGG 1 cut(s) 85
BlsI GCNGC 1 cut(s) 14
Bme1390I CCNGG 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 39
BmrI ACTGGG 1 cut(s) 178
BmuI ACTGGG 1 cut(s) 178
BpiI GAAGAC 1 cut(s) 237
BpmI CTGGAG 1 cut(s) 60
BpuEI CTTGAG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 184
Bse3DI GCAATG 1 cut(s) 177
BseBI CCWGG 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 85
BseMI GCAATG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 184
BseXI GCAGC 1 cut(s) 24
BshFI GGCC 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 238
BsmBI CGTCTC 1 cut(s) 238
BsnI GGCC 1 cut(s) 160
BspANI GGCC 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 177
BsrI ACTGG 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 85
BssT1I CCWWGG 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 162
BstHHI GCGC 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 238
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
BstV1I GCAGC 1 cut(s) 24
BstV2I GAAGAC 1 cut(s) 237
BsuRI GGCC 1 cut(s) 160
Cac8I GCNNGC 1 cut(s) 162
CfoI GCGC 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 158
Csp6I GTAC 1 cut(s) 4
CspCI CAANNNNNGTGG 2 cut(s) 121, 156
CviAII CATG 3 cut(s) 227, 241, 258
CviJI RGCY 3 cut(s) 15, 37, 160
CviKI_1 RGCY 3 cut(s) 15, 37, 160
CviQI GTAC 1 cut(s) 4
Eco130I CCWWGG 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 85
ErhI CCWWGG 1 cut(s) 85
Esp3I CGTCTC 1 cut(s) 238
FaeI CATG 3 cut(s) 230, 244, 261
FaiI YATR 4 cut(s) 27, 228, 242, 259
FatI CATG 3 cut(s) 226, 240, 257
Fnu4HI GCNGC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 13
FspBI CTAG 1 cut(s) 86
GlaI GCGC 1 cut(s) 195
GluI GCNGC 1 cut(s) 13
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 160
HhaI GCGC 1 cut(s) 196
Hin1II CATG 3 cut(s) 230, 244, 261
Hin6I GCGC 1 cut(s) 194
HinP1I GCGC 1 cut(s) 194
HphI GGTGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
Hsp92II CATG 3 cut(s) 230, 244, 261
HspAI GCGC 1 cut(s) 194
LpnPI CCDG 8 cut(s) 24, 36, 51, 140, 174, 197, 204, 228
Lsp1109I GCAGC 1 cut(s) 24
MaeI CTAG 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 79
MboII GAAGA 1 cut(s) 242
MluCI AATT 3 cut(s) 90, 112, 251
MseI TTAA 1 cut(s) 110
MslI CAYNNNNRTG 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 56
NlaIII CATG 3 cut(s) 230, 244, 261
NlaIV GGNNCC 1 cut(s) 159
NmuCI GTSAC 1 cut(s) 79
PflFI GACNNNGTC 1 cut(s) 215
PkrI GCNGC 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 159
PspPI GGNCC 1 cut(s) 158
PsyI GACNNNGTC 1 cut(s) 215
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 239
SaqAI TTAA 1 cut(s) 110
SatI GCNGC 1 cut(s) 13
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 39
SetI ASST 2 cut(s) 17, 110
SmiMI CAYNNNNRTG 1 cut(s) 239
SmlI CTYRAG 1 cut(s) 207
SmoI CTYRAG 1 cut(s) 207
Sse9I AATT 3 cut(s) 90, 112, 251
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 37
StyI CCWWGG 1 cut(s) 85
TaaI ACNGT 1 cut(s) 23
TasI AATT 3 cut(s) 90, 112, 251
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TseFI GTSAC 1 cut(s) 79
TseI GCWGC 1 cut(s) 12
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 243
Tth111I GACNNNGTC 1 cut(s) 215
XapI RAATTY 2 cut(s) 90, 112
XmaJI CCTAGG 1 cut(s) 85
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.