Rmu_co8134734.1_g000001

U4 U6.U5 tri-snRNP-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8134734.1
Physical Location & Seq
Reverse (-)
1 .. 634
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8134734.1_g000001.1.cds

Sequence Viewer

Length: 320 bp
gatcgagagaaggggagggaaagcttgaaggatactgatagggagaaggggaaagataaatatagggaaaaggagagggaggcagatcaagataaggagaaatcaagagacagacagagcaggagaagcgtggatgcttatgagtcgagcaagattggggaaagggatgagagtgctaagcttaatgatgacgataacagggataaggacattattaagcaaggtaagatgtcccataatgcttcttatgaacaaaatgccgagggtttgtcaggtggagcgcatctatcagcatccgagcttgaggaacgcatcctgaa

Protein Analysis

106

Amino Acids

12.24

Weight (kDa)

5.35

Isoelectric Point (pI)

39.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 3 cut(s) 24, 181, 301
AluI AGCT 3 cut(s) 24, 181, 301
Alw26I GTCTC 1 cut(s) 102
AspLEI GCGC 1 cut(s) 283
BciVI GTATCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 102
BfuI GTATCC 1 cut(s) 25
BlpI GCTNAGC 1 cut(s) 177
BmsI GCATC 3 cut(s) 124, 292, 302
Bpu1102I GCTNAGC 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 261
BseGI GGATG 4 cut(s) 139, 172, 293, 312
BslFI GGGAC 1 cut(s) 217
BsmAI GTCTC 1 cut(s) 102
BsmFI GGGAC 1 cut(s) 217
Bsp143I GATC 1 cut(s) 85
Bsp1720I GCTNAGC 1 cut(s) 177
BssECI CCNNGG 1 cut(s) 261
BssMI GATC 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 4 cut(s) 139, 172, 293, 312
BstHHI GCGC 1 cut(s) 283
BstKTI GATC 2 cut(s) 4, 88
BstMAI GTCTC 1 cut(s) 102
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 1 cut(s) 126
BsuI GTATCC 1 cut(s) 25
BtsCI GGATG 4 cut(s) 139, 172, 293, 312
CfoI GCGC 1 cut(s) 283
CviJI RGCY 3 cut(s) 24, 181, 301
CviKI_1 RGCY 3 cut(s) 24, 181, 301
DdeI CTNAG 1 cut(s) 177
DpnI GATC 2 cut(s) 3, 87
DpnII GATC 1 cut(s) 85
FaiI YATR 4 cut(s) 63, 141, 237, 249
FaqI GGGAC 1 cut(s) 217
FokI GGATG 4 cut(s) 146, 179, 280, 299
GlaI GCGC 1 cut(s) 282
HhaI GCGC 1 cut(s) 283
Hin6I GCGC 1 cut(s) 281
HinP1I GCGC 1 cut(s) 281
HindIII AAGCTT 2 cut(s) 22, 179
HinfI GANTC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 298
Hpy188III TCNNGA 4 cut(s) 5, 89, 105, 316
HpyAV CCTTC 3 cut(s) 4, 22, 40
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 177
HspAI GCGC 1 cut(s) 281
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 1 cut(s) 278
LpnPI CCDG 3 cut(s) 106, 184, 258
LweI GCATC 3 cut(s) 124, 292, 302
MalI GATC 2 cut(s) 3, 87
MboI GATC 1 cut(s) 85
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 5 cut(s) 9, 69, 73, 256, 298
MseI TTAA 2 cut(s) 183, 216
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 1 cut(s) 85
NmeAIII GCCGAG 1 cut(s) 286
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
SaqAI TTAA 2 cut(s) 183, 216
Sau3AI GATC 1 cut(s) 85
SchI GAGTC 1 cut(s) 152
SetI ASST 5 cut(s) 26, 183, 226, 277, 303
SfaNI GCATC 3 cut(s) 124, 292, 302
SmlI CTYRAG 1 cut(s) 302
SmoI CTYRAG 1 cut(s) 302
TaqI TCGA 2 cut(s) 4, 146
Tru1I TTAA 2 cut(s) 183, 216
Tru9I TTAA 2 cut(s) 183, 216
TspDTI ATGAA 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.