Rmu_co8161348.1_g000001

Peptidyl-prolyl

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8161348.1
Physical Location & Seq
Reverse (-)
1 .. 581
581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8161348.1_g000001.1.cds

Sequence Viewer

Length: 379 bp
atgaagaagggtgagaatgcaattttcaccataccacccgagttggcttatggcgagtctggatcccctccaactattcctcccaatgccacactccagtttgatgtggagttgctttcctggactagtgtcaaggacatatgcaaggatggcggagttataaagaaaattcttactgaaggggagaaatgggagaatccaaaagacctcgatgaagtatttgttaagtatgaggctcgacttgaagatgggactcttgtttcaaaatctgatggggtggagtttactgttgaagatggctatttctgcccagccttggcaaaagctgtgaaaacaatgaagaaaaatgaaaaggtccatttgatcgtaaaaccacaat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.97

Weight (kDa)

5.09

Isoelectric Point (pI)

24.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014948)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 161
AciI CCGC 1 cut(s) 153
AclWI GGATC 2 cut(s) 57, 70
AcsI RAATTY 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 198
AfiI CCNNNNNNNGG 1 cut(s) 316
AgsI TTSAA 3 cut(s) 245, 264, 293
AhlI ACTAGT 1 cut(s) 125
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 1 cut(s) 326
AluI AGCT 1 cut(s) 326
AlwI GGATC 2 cut(s) 57, 70
Ama87I CYCGRG 1 cut(s) 38
ApoI RAATTY 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 355
AsuHPI GGTGA 2 cut(s) 19, 23
AvaI CYCGRG 1 cut(s) 38
AvaII GGWCC 1 cut(s) 355
BamHI GGATCC 1 cut(s) 62
BccI CCATC 4 cut(s) 143, 242, 266, 290
BciT130I CCWGG 1 cut(s) 121
BcuI ACTAGT 1 cut(s) 125
BfaI CTAG 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 355
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 355
BmiI GGNNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 121
BoxI GACNNNNGTC 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 315
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
Bsc4I CCNNNNNNNGG 1 cut(s) 316
Bse1I ACTGG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 121
BseDI CCNNGG 1 cut(s) 315
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 316
BseNI ACTGG 1 cut(s) 97
BseYI CCCAGC 1 cut(s) 310
BsiHKCI CYCGRG 1 cut(s) 38
BslFI GGGAC 1 cut(s) 265
BslI CCNNNNNNNGG 1 cut(s) 316
BsmFI GGGAC 1 cut(s) 265
BsmI GAATGC 1 cut(s) 22
BsoBI CYCGRG 1 cut(s) 38
Bsp143I GATC 2 cut(s) 62, 363
BspACI CCGC 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 64
BspPI GGATC 2 cut(s) 57, 70
BsrI ACTGG 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 315
BssMI GATC 2 cut(s) 62, 363
BssT1I CCWWGG 1 cut(s) 315
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 289
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 2 cut(s) 65, 366
BstMBI GATC 2 cut(s) 62, 363
BstMWI GCNNNNNNNGC 2 cut(s) 150, 306
BstNI CCWGG 1 cut(s) 121
BstPAI GACNNNNGTC 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BtsCI GGATG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 355
CspCI CAANNNNNGTGG 2 cut(s) 24, 59
CviJI RGCY 5 cut(s) 47, 236, 300, 314, 326
CviKI_1 RGCY 5 cut(s) 47, 236, 300, 314, 326
DpnI GATC 2 cut(s) 64, 365
DpnII GATC 2 cut(s) 62, 363
EciI GGCGGA 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 355
Eco57I CTGAAG 1 cut(s) 198
Eco88I CYCGRG 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 315
ErhI CCWWGG 1 cut(s) 315
FaiI YATR 6 cut(s) 32, 51, 140, 142, 161, 231
FaqI GGGAC 1 cut(s) 265
FauNDI CATATG 1 cut(s) 140
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 126
GsaI CCCAGC 1 cut(s) 314
GsuI CTGGAG 1 cut(s) 80
HinfI GANTC 3 cut(s) 56, 196, 253
HphI GGTGA 2 cut(s) 19, 23
Hpy166II GTNNAC 1 cut(s) 285
Hpy188I TCNGA 1 cut(s) 271
Hpy188III TCNNGA 1 cut(s) 60
Hpy8I GTNNAC 1 cut(s) 285
HpyAV CCTTC 1 cut(s) 173
HpyCH4III ACNGT 1 cut(s) 289
HpyCH4V TGCA 2 cut(s) 20, 144
HpyF10VI GCNNNNNNNGC 2 cut(s) 150, 306
Kzo9I GATC 2 cut(s) 62, 363
LpnPI CCDG 5 cut(s) 45, 106, 110, 133, 324
MaeI CTAG 1 cut(s) 126
MalI GATC 2 cut(s) 64, 365
MboI GATC 2 cut(s) 62, 363
MboII GAAGA 4 cut(s) 16, 257, 305, 352
MflI RGATCY 1 cut(s) 62
MluCI AATT 2 cut(s) 21, 168
MlyI GAGTC 2 cut(s) 65, 247
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 4 cut(s) 78, 90, 218, 226
MseI TTAA 1 cut(s) 225
MspR9I CCNGG 1 cut(s) 121
Mva1269I GAATGC 1 cut(s) 22
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 2 cut(s) 150, 306
NdeI CATATG 1 cut(s) 140
NdeII GATC 2 cut(s) 62, 363
NlaIV GGNNCC 1 cut(s) 64
PctI GAATGC 1 cut(s) 22
PfeI GAWTC 1 cut(s) 196
PfoI TCCNGGA 1 cut(s) 119
PleI GAGTC 2 cut(s) 64, 247
PpsI GAGTC 2 cut(s) 64, 247
PshAI GACNNNNGTC 1 cut(s) 128
PsiI TTATAA 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 119
PspFI CCCAGC 1 cut(s) 310
PspGI CCWGG 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 355
PsuI RGATCY 1 cut(s) 62
SaqAI TTAA 1 cut(s) 225
Sau3AI GATC 2 cut(s) 62, 363
Sau96I GGNCC 1 cut(s) 355
SchI GAGTC 2 cut(s) 65, 247
ScrFI CCNGG 1 cut(s) 121
SetI ASST 3 cut(s) 210, 328, 357
SinI GGWCC 1 cut(s) 355
SpeI ACTAGT 1 cut(s) 125
Sse9I AATT 2 cut(s) 21, 168
SsiI CCGC 1 cut(s) 153
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 119
StyI CCWWGG 1 cut(s) 315
TaaI ACNGT 1 cut(s) 289
TaqI TCGA 2 cut(s) 210, 238
TasI AATT 2 cut(s) 21, 168
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TspDTI ATGAA 4 cut(s) 17, 228, 353, 363
VpaK11BI GGWCC 1 cut(s) 355
XapI RAATTY 1 cut(s) 168
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.