Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8187456.1

Orthogroup ID

OG0004597

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 605

Gene Structure 605 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8187456.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 605 bp

tgccaaaaagattggttacagtacttcttagcaagaactcgttctcaggaaagattccggtgcaatttggtgatttgagtcagcttcaacaccttgatctatcattcaattatctcagtggagcaccaccctctaacttgttctctttgccagaaatcagttatctgaatttagcatccaatatgctgagtggaccatttccaaacggtctaaattgtggtggcaaacttggttttgttgatatttctaataacaagttagcaggggatcttccttcttgcctgggtagtacctcagatgagagagttgttgaactcagcggtaactgtttggccaatgcttcccaacaccagcatgaccattcatattgtacaaaggctcttgcaaggagaaaacaatctagtgtgagagagattgtggtgctagttgctgttgccatcggagcacttcttgttttagtactttctgtacttgcggttatttgcttgtgtagaagataccgttcaaggaagtctgagcataacatatttgcaaaagctgtgccagataattcaccaaatgatctttgctcgaacatcgttacaaatgctagtaagttgtattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_1 LRR_8 Pkinase_Tyr

Protein Analysis

200

Amino Acids

21.56

Weight (kDa)

9.04

Isoelectric Point (pI)

46.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004597)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G14210 AT5G14210 AT5G14210
fragaria_vesca	FvH4_6g52940 FvH4_6g53110 FvH4_6g53110 FvH4_6g53110 FvH4_6g53110 FvH4_6g53110 FvH4_6g53110 FvH4_6g53110
malus_domestica	MD09G1014600.v1.1 MD17G1014600.v1.1
prunus_persica	Prupe.3G303100_v2.0.a1 Prupe.3G303100_v2.0.a1
pyrus_communis	pycom111g01190
rosa_chinensis	RchiOBHm_Chr2g0174981
rosa_laevigata	RLG00000022304
rosa_multiflora	Rmu_co8187456.1_g000001 Rmu_sc0001277.1_g000005
rosa_roxburghii	Rroxscaffold_2G00077610
rosa_rugosa	Rorug02G0580500 Rorug02G0580600 Rorug02G0580700 Rorug02G0580700 Rorug02G0580800
rosa_samantha	Rh2AG661600 Rh2BG672900 Rh2CG636000 Rh2DG686500
rosa_wichuraiana	Rw2G054230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	320, 475
AclWI	GGATC	1 cut(s)	275
AcoI	YGGCCR	1 cut(s)	332
AcsI	RAATTY	1 cut(s)	168
AfaI	GTAC	5 cut(s)	23, 291, 372, 461, 470
AgsI	TTSAA	4 cut(s)	88, 108, 313, 506
AjnI	CCWGG	1 cut(s)	281
AluBI	AGCT	2 cut(s)	84, 538
AluI	AGCT	2 cut(s)	84, 538
Alw21I	GWGCWC	2 cut(s)	126, 447
AlwI	GGATC	1 cut(s)	275
AoxI	GGCC	1 cut(s)	332
ApoI	RAATTY	1 cut(s)	168
Asp700I	GAANNNNTTC	1 cut(s)	40
AspS9I	GGNCC	1 cut(s)	193
AsuHPI	GGTGA	2 cut(s)	82, 545
AvaII	GGWCC	1 cut(s)	193
BalI	TGGCCA	1 cut(s)	334
Bbv12I	GWGCWC	2 cut(s)	126, 447
BccI	CCATC	1 cut(s)	445
BciT130I	CCWGG	1 cut(s)	283
BfaI	CTAG	3 cut(s)	401, 424, 590
BmcAI	AGTACT	2 cut(s)	23, 461
Bme1390I	CCNGG	1 cut(s)	283
Bme18I	GGWCC	1 cut(s)	193
BmgT120I	GGNCC	1 cut(s)	193
BmrFI	CCNGG	1 cut(s)	283
BmsI	GCATC	1 cut(s)	184
BsaJI	CCNNGG	1 cut(s)	282
BsaWI	WCCGGW	1 cut(s)	57
BseBI	CCWGG	1 cut(s)	283
BseDI	CCNNGG	1 cut(s)	282
BseGI	GGATG	1 cut(s)	175
BseMII	CTCAG	6 cut(s)	59, 129, 178, 308, 330, 506
BshFI	GGCC	1 cut(s)	334
BsiHKAI	GWGCWC	2 cut(s)	126, 447
BsiSI	CCGG	1 cut(s)	58
BsnI	GGCC	1 cut(s)	334
Bsp1286I	GDGCHC	2 cut(s)	126, 447
Bsp1407I	TGTACA	1 cut(s)	370
Bsp143I	GATC	3 cut(s)	96, 267, 561
BspACI	CCGC	2 cut(s)	320, 475
BspANI	GGCC	1 cut(s)	334
BspCNI	CTCAG	6 cut(s)	58, 128, 179, 307, 329, 507
BspPI	GGATC	1 cut(s)	275
BsrGI	TGTACA	1 cut(s)	370
BssECI	CCNNGG	1 cut(s)	282
BssMI	GATC	3 cut(s)	96, 267, 561
Bst2UI	CCWGG	1 cut(s)	283
Bst4CI	ACNGT	4 cut(s)	21, 208, 328, 502
BstAUI	TGTACA	1 cut(s)	370
BstDEI	CTNAG	7 cut(s)	28, 45, 115, 187, 294, 316, 515
BstF5I	GGATG	1 cut(s)	175
BstKTI	GATC	3 cut(s)	99, 270, 564
BstMBI	GATC	3 cut(s)	96, 267, 561
BstMWI	GCNNNNNNNGC	1 cut(s)	442
BstNI	CCWGG	1 cut(s)	283
BstSCI	CCNGG	1 cut(s)	281
BstX2I	RGATCY	1 cut(s)	267
BstYI	RGATCY	1 cut(s)	267
BsuRI	GGCC	1 cut(s)	334
BtsCI	GGATG	1 cut(s)	175
BtsIMutI	CAGTG	1 cut(s)	123
Cfr13I	GGNCC	1 cut(s)	193
Csp6I	GTAC	5 cut(s)	22, 290, 371, 460, 469
CviAII	CATG	1 cut(s)	355
CviJI	RGCY	4 cut(s)	84, 334, 379, 538
CviKI_1	RGCY	4 cut(s)	84, 334, 379, 538
CviQI	GTAC	5 cut(s)	22, 290, 371, 460, 469
DdeI	CTNAG	7 cut(s)	28, 45, 115, 187, 294, 316, 515
DpnI	GATC	3 cut(s)	98, 269, 563
DpnII	GATC	3 cut(s)	96, 267, 561
EaeI	YGGCCR	1 cut(s)	332
Eco47I	GGWCC	1 cut(s)	193
EcoRII	CCWGG	1 cut(s)	281
FaeI	CATG	1 cut(s)	358
FaiI	YATR	5 cut(s)	184, 356, 366, 521, 526
FatI	CATG	1 cut(s)	354
FokI	GGATG	1 cut(s)	162
FspBI	CTAG	3 cut(s)	401, 424, 590
HaeIII	GGCC	1 cut(s)	334
HapII	CCGG	1 cut(s)	58
Hin1II	CATG	1 cut(s)	358
HinfI	GANTC	2 cut(s)	54, 78
HpaII	CCGG	1 cut(s)	58
HphI	GGTGA	2 cut(s)	82, 545
Hpy166II	GTNNAC	1 cut(s)	193
Hpy188I	TCNGA	4 cut(s)	167, 297, 442, 516
Hpy188III	TCNNGA	1 cut(s)	47
Hpy8I	GTNNAC	1 cut(s)	193
HpyAV	CCTTC	1 cut(s)	284
HpyCH4III	ACNGT	4 cut(s)	21, 208, 328, 502
HpyCH4V	TGCA	3 cut(s)	63, 385, 532
HpyF10VI	GCNNNNNNNGC	1 cut(s)	442
HpyF3I	CTNAG	7 cut(s)	28, 45, 115, 187, 294, 316, 515
Hsp92II	CATG	1 cut(s)	358
Kzo9I	GATC	3 cut(s)	96, 267, 561
LmnI	GCTCC	2 cut(s)	121, 442
LpnPI	CCDG	8 cut(s)	32, 71, 164, 248, 268, 295, 364, 557
LweI	GCATC	1 cut(s)	184
MaeI	CTAG	3 cut(s)	401, 424, 590
MaeIII	GTNAC	3 cut(s)	15, 322, 579
MalI	GATC	3 cut(s)	98, 269, 563
MboI	GATC	3 cut(s)	96, 267, 561
MboII	GAAGA	2 cut(s)	262, 506
MflI	RGATCY	1 cut(s)	267
MhlI	GDGCHC	2 cut(s)	126, 447
MlsI	TGGCCA	1 cut(s)	334
MluCI	AATT	5 cut(s)	64, 108, 168, 213, 549
MluNI	TGGCCA	1 cut(s)	334
MlyI	GAGTC	1 cut(s)	87
MnlI	CCTC	2 cut(s)	141, 303
Mox20I	TGGCCA	1 cut(s)	334
MroXI	GAANNNNTTC	1 cut(s)	40
MscI	TGGCCA	1 cut(s)	334
MslI	CAYNNNNRTG	1 cut(s)	353
Msp20I	TGGCCA	1 cut(s)	334
MspA1I	CMGCKG	1 cut(s)	320
MspI	CCGG	1 cut(s)	58
MspR9I	CCNGG	1 cut(s)	283
MvaI	CCWGG	1 cut(s)	283
MwoI	GCNNNNNNNGC	1 cut(s)	442
NdeII	GATC	3 cut(s)	96, 267, 561
NlaIII	CATG	1 cut(s)	358
PdmI	GAANNNNTTC	1 cut(s)	40
PfeI	GAWTC	1 cut(s)	54
PleI	GAGTC	1 cut(s)	86
PpsI	GAGTC	1 cut(s)	86
Psp6I	CCWGG	1 cut(s)	281
PspGI	CCWGG	1 cut(s)	281
PspPI	GGNCC	1 cut(s)	193
PsuI	RGATCY	1 cut(s)	267
RsaI	GTAC	5 cut(s)	23, 291, 372, 461, 470
RsaNI	GTAC	5 cut(s)	22, 290, 371, 460, 469
RseI	CAYNNNNRTG	1 cut(s)	353
Sau3AI	GATC	3 cut(s)	96, 267, 561
Sau96I	GGNCC	1 cut(s)	193
ScaI	AGTACT	2 cut(s)	23, 461
SchI	GAGTC	1 cut(s)	87
ScrFI	CCNGG	1 cut(s)	283
SduI	GDGCHC	2 cut(s)	126, 447
SetI	ASST	4 cut(s)	86, 95, 295, 540
SfaNI	GCATC	1 cut(s)	184
SinI	GGWCC	1 cut(s)	193
SmiMI	CAYNNNNRTG	1 cut(s)	353
Sse9I	AATT	5 cut(s)	64, 108, 168, 213, 549
SsiI	CCGC	2 cut(s)	320, 475
SspMI	CTAG	3 cut(s)	401, 424, 590
StyD4I	CCNGG	1 cut(s)	281
TaaI	ACNGT	4 cut(s)	21, 208, 328, 502
TaqI	TCGA	1 cut(s)	571
TasI	AATT	5 cut(s)	64, 108, 168, 213, 549
TatI	WGTACW	4 cut(s)	21, 370, 459, 468
TfiI	GAWTC	1 cut(s)	54
TscAI	CASTG	1 cut(s)	123
TspDTI	ATGAA	1 cut(s)	353
TspRI	CASTG	1 cut(s)	123
VpaK11BI	GGWCC	1 cut(s)	193
XapI	RAATTY	1 cut(s)	168
XmnI	GAANNNNTTC	1 cut(s)	40
XspI	CTAG	3 cut(s)	401, 424, 590
ZrmI	AGTACT	2 cut(s)	23, 461

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.