Rmu_co8203624.1_g000001

WW domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8203624.1
Physical Location & Seq
Forward (+)
380 .. 715
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8203624.1_g000001.1.cds

Sequence Viewer

Length: 251 bp
atgcttccatgtattgctgtcataacaggtaacttagaaattggaaacggctatggcgtaccaggcggaggtgcttatcagggtgggacgaggtctaatagtactccacctaggaatttgggagttggaatcaatgaaatgggacagatgaactttgtgcctgataaggaatttgaacagaaacctccatctaaagaattgtccgagtatcttaagaaaaagttgcgagataggggtattcttaaagaaga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000375 GO:0000377 GO:0000380 GO:0000398 GO:0001817 GO:0001819 GO:0002218 GO:0002230 GO:0002252 GO:0002253 GO:0002376 GO:0002682 GO:0002684 GO:0002697 GO:0002831 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003712 GO:0003713 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005829 GO:0006139 GO:0006355 GO:0006396 GO:0006397 GO:0006725 GO:0006807 GO:0006950 GO:0006952 GO:0007275 GO:0007399 GO:0008150 GO:0008152 GO:0008380 GO:0009605 GO:0009607 GO:0009615 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010033 GO:0010467 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0014070 GO:0016043 GO:0016070 GO:0016071 GO:0016604 GO:0016607 GO:0019219 GO:0019222 GO:0022008 GO:0030030 GO:0030154 GO:0030182 GO:0031175 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031347 GO:0031349 GO:0031974 GO:0031981 GO:0032101 GO:0032479 GO:0032481 GO:0032501 GO:0032502 GO:0034641 GO:0042221 GO:0043021 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043330 GO:0043331 GO:0043484 GO:0043900 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044451 GO:0044464 GO:0044877 GO:0045088 GO:0045089 GO:0045935 GO:0046483 GO:0048468 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0048666 GO:0048699 GO:0048731 GO:0048856 GO:0048869 GO:0050688 GO:0050691 GO:0050776 GO:0050778 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051239 GO:0051240 GO:0051252 GO:0051254 GO:0051607 GO:0051704 GO:0051707 GO:0051716 GO:0060255 GO:0065007 GO:0070013 GO:0070887 GO:0071310 GO:0071359 GO:0071360 GO:0071407 GO:0071704 GO:0071840 GO:0080090 GO:0080134 GO:0090304 GO:0097159 GO:0098542 GO:0120036 GO:0140110 GO:1901360 GO:1901363 GO:1901698 GO:1901699 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

8.99

Weight (kDa)

8.82

Isoelectric Point (pI)

23.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 66
AcsI RAATTY 2 cut(s) 115, 170
AfaI GTAC 2 cut(s) 60, 103
AfiI CCNNNNNNNGG 1 cut(s) 68
AflII CTTAAG 1 cut(s) 212
AgsI TTSAA 1 cut(s) 176
AjnI CCWGG 1 cut(s) 61
ApoI RAATTY 2 cut(s) 115, 170
AspA2I CCTAGG 1 cut(s) 110
AvrII CCTAGG 1 cut(s) 110
BccI CCATC 1 cut(s) 196
BceAI ACGGC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 1 cut(s) 111
BfrI CTTAAG 1 cut(s) 212
BlnI CCTAGG 1 cut(s) 110
BmcAI AGTACT 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 110
Bsc4I CCNNNNNNNGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 68
BslFI GGGAC 2 cut(s) 100, 156
BslI CCNNNNNNNGG 1 cut(s) 68
BsmFI GGGAC 2 cut(s) 100, 156
BspACI CCGC 1 cut(s) 66
BspTI CTTAAG 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 110
BssT1I CCWWGG 1 cut(s) 110
Bst2UI CCWGG 1 cut(s) 63
BstAFI CTTAAG 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
Csp6I GTAC 2 cut(s) 59, 102
CviAII CATG 1 cut(s) 9
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
CviQI GTAC 2 cut(s) 59, 102
DdeI CTNAG 1 cut(s) 34
EciI GGCGGA 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 110
FaeI CATG 1 cut(s) 12
FaiI YATR 3 cut(s) 10, 23, 54
FaqI GGGAC 2 cut(s) 100, 156
FatI CATG 1 cut(s) 8
FspBI CTAG 1 cut(s) 111
Hin1II CATG 1 cut(s) 12
HinfI GANTC 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 1 cut(s) 12
LpnPI CCDG 5 cut(s) 12, 48, 65, 75, 174
MaeI CTAG 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 29
MluCI AATT 4 cut(s) 39, 115, 170, 197
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 3 cut(s) 62, 84, 195
MseI TTAA 2 cut(s) 213, 243
MspCI CTTAAG 1 cut(s) 212
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 63
NlaIII CATG 1 cut(s) 12
PcsI WCGNNNNNNNCGW 1 cut(s) 54
PfeI GAWTC 1 cut(s) 129
PflFI GACNNNGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PsyI GACNNNGTC 1 cut(s) 91
RsaI GTAC 2 cut(s) 60, 103
RsaNI GTAC 2 cut(s) 59, 102
SaqAI TTAA 2 cut(s) 213, 243
ScaI AGTACT 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 63
SetI ASST 5 cut(s) 31, 73, 95, 112, 187
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 4 cut(s) 39, 115, 170, 197
SsiI CCGC 1 cut(s) 66
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 61
StyI CCWWGG 1 cut(s) 110
TasI AATT 4 cut(s) 39, 115, 170, 197
TatI WGTACW 1 cut(s) 101
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 2 cut(s) 213, 243
Tru9I TTAA 2 cut(s) 213, 243
TspDTI ATGAA 2 cut(s) 150, 164
Tth111I GACNNNGTC 1 cut(s) 91
Vha464I CTTAAG 1 cut(s) 212
XapI RAATTY 2 cut(s) 115, 170
XmaJI CCTAGG 1 cut(s) 110
XspI CTAG 1 cut(s) 111
ZrmI AGTACT 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.