Rmu_co8218640.1_g000001

NifU-like protein 2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8218640.1
Physical Location & Seq
Reverse (-)
1 .. 544
544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8218640.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atgaacttcacagttgttaaggcggttgctactccaaattcagccgtggaattaccattgactgcagaaaatgtggaaagtgtattagatgaaatccggccatatctcatttctgatggggggaatgtggcattacatgaaattgatggcaatatagtgcggttaaagctacaaggagcatgtggatcgtgtccaagttctgttatgacaatgaaaatgggtattgagcgacgtttaatggaaaaaatccctgaaatagttgctgtggaaccaatagcagatgaagaaacaggccttgagctgaatgaagaaaatatagagaag

Protein Analysis

108

Amino Acids

11.74

Weight (kDa)

4.42

Isoelectric Point (pI)

60.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 23, 160
AclWI GGATC 1 cut(s) 193
AcoI YGGCCR 1 cut(s) 98
AcsI RAATTY 1 cut(s) 37
AluBI AGCT 2 cut(s) 169, 301
AluI AGCT 2 cut(s) 169, 301
AlwI GGATC 1 cut(s) 193
AoxI GGCC 2 cut(s) 98, 292
ApoI RAATTY 1 cut(s) 37
BccI CCATC 2 cut(s) 110, 140
BceAI ACGGC 1 cut(s) 29
BcgI CGANNNNNNTGC 2 cut(s) 168, 202
BfmI CTRYAG 1 cut(s) 63
BmiI GGNNCC 1 cut(s) 270
BpuEI CTTGAG 1 cut(s) 317
BsaJI CCNNGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 45
BshFI GGCC 2 cut(s) 100, 294
BsiSI CCGG 1 cut(s) 97
BsnI GGCC 2 cut(s) 100, 294
Bsp143I GATC 1 cut(s) 185
BspACI CCGC 2 cut(s) 23, 160
BspANI GGCC 2 cut(s) 100, 294
BspLI GGNNCC 1 cut(s) 270
BspMAI CTGCAG 1 cut(s) 67
BspPI GGATC 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 1 cut(s) 185
Bst4CI ACNGT 1 cut(s) 13
BstDSI CCRYGG 1 cut(s) 45
BstKTI GATC 1 cut(s) 188
BstMBI GATC 1 cut(s) 185
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 183
BstSFI CTRYAG 1 cut(s) 63
BsuRI GGCC 2 cut(s) 100, 294
BtgI CCRYGG 1 cut(s) 45
CviAII CATG 2 cut(s) 137, 180
CviJI RGCY 5 cut(s) 44, 100, 169, 294, 301
CviKI_1 RGCY 5 cut(s) 44, 100, 169, 294, 301
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 98
Eco147I AGGCCT 1 cut(s) 294
FaeI CATG 2 cut(s) 140, 183
FaiI YATR 6 cut(s) 103, 138, 155, 181, 206, 317
FatI CATG 2 cut(s) 136, 179
HaeIII GGCC 2 cut(s) 100, 294
HapII CCGG 1 cut(s) 97
Hin1II CATG 2 cut(s) 140, 183
HpaII CCGG 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 115
Hpy99I CGWCG 1 cut(s) 234
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 232
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 232
Hsp92II CATG 2 cut(s) 140, 183
Kzo9I GATC 1 cut(s) 185
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 3 cut(s) 110, 264, 276
MaeII ACGT 1 cut(s) 232
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 2 cut(s) 296, 320
MluCI AATT 3 cut(s) 37, 50, 141
MseI TTAA 3 cut(s) 18, 164, 236
MspI CCGG 1 cut(s) 97
MwoI GCNNNNNNNGC 1 cut(s) 166
NdeII GATC 1 cut(s) 185
NlaIII CATG 2 cut(s) 140, 183
NlaIV GGNNCC 1 cut(s) 270
NspI RCATGY 1 cut(s) 183
PceI AGGCCT 1 cut(s) 294
PspN4I GGNNCC 1 cut(s) 270
PstI CTGCAG 1 cut(s) 67
SaqAI TTAA 3 cut(s) 18, 164, 236
Sau3AI GATC 1 cut(s) 185
SetI ASST 3 cut(s) 171, 235, 303
SfcI CTRYAG 1 cut(s) 63
SmlI CTYRAG 1 cut(s) 296
SmoI CTYRAG 1 cut(s) 296
Sse9I AATT 3 cut(s) 37, 50, 141
SseBI AGGCCT 1 cut(s) 294
SsiI CCGC 2 cut(s) 23, 160
StuI AGGCCT 1 cut(s) 294
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 235
TasI AATT 3 cut(s) 37, 50, 141
Tru1I TTAA 3 cut(s) 18, 164, 236
Tru9I TTAA 3 cut(s) 18, 164, 236
TspDTI ATGAA 6 cut(s) 17, 105, 153, 227, 297, 321
XapI RAATTY 1 cut(s) 37
XceI RCATGY 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.