Rmu_co8235109.1_g000001
MYB Family

TSL-kinase interacting protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8235109.1
Physical Location & Seq
Forward (+)
62 .. 763
702 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8235109.1_g000001.1.cds

Sequence Viewer

Length: 491 bp
atgcccaattttccacaaaatatttatgcagagaacaacataaacaactctgtgaagcttaaactccagttgttcccaattgatgatagtactagaaaagccttggaaatggataaacataatcctcacctggagcttacgctccctactcggaaaaagatatcctcagttatggaacacctaaatcgcaaatggggaagttcaagtgtggcatcaggagagctaatgcttttccctaatagtgtccagcaggattgtccaacaggctatctgagatggacacaagactcaaatgtcagtgcaggagatgtatatgctatgattggaagccctccagttttccgattaaggtatggttggttctccactactgagcttggatctgtttcatcgcaagcacctgtagcatcttgcacgattccagttgagcatgatatgaatgtggagaagatgaaggatcctgtattggaatcagcatctatttctccact
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

18.3

Weight (kDa)

6.06

Isoelectric Point (pI)

60.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 293
AclWI GGATC 3 cut(s) 388, 452, 465
AfaI GTAC 1 cut(s) 91
AgsI TTSAA 1 cut(s) 204
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 4 cut(s) 58, 136, 223, 376
AluI AGCT 4 cut(s) 58, 136, 223, 376
AlwI GGATC 3 cut(s) 388, 452, 465
AsuHPI GGTGA 1 cut(s) 119
BamHI GGATCC 1 cut(s) 457
BccI CCATC 1 cut(s) 270
BciT130I CCWGG 1 cut(s) 131
BfaI CTAG 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 402
BmcAI AGTACT 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 459
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 3 cut(s) 221, 416, 485
BpmI CTGGAG 3 cut(s) 50, 152, 318
BsaJI CCNNGG 1 cut(s) 102
Bse1I ACTGG 3 cut(s) 67, 335, 422
BseBI CCWGG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 102
BseMII CTCAG 3 cut(s) 180, 263, 363
BseNI ACTGG 3 cut(s) 67, 335, 422
BsgI GTGCAG 1 cut(s) 321
Bsp143I GATC 2 cut(s) 380, 457
BspCNI CTCAG 3 cut(s) 179, 264, 364
BspLI GGNNCC 1 cut(s) 459
BspPI GGATC 3 cut(s) 388, 452, 465
BsrI ACTGG 3 cut(s) 67, 335, 422
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 2 cut(s) 380, 457
BssT1I CCWWGG 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 396
BstDEI CTNAG 3 cut(s) 166, 272, 372
BstKTI GATC 2 cut(s) 383, 460
BstMBI GATC 2 cut(s) 380, 457
BstMWI GCNNNNNNNGC 1 cut(s) 404
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstSFI CTRYAG 1 cut(s) 402
BstX2I RGATCY 2 cut(s) 380, 457
BstYI RGATCY 2 cut(s) 380, 457
BtgZI GCGATG 1 cut(s) 375
BtsIMutI CAGTG 1 cut(s) 304
Cac8I GCNNGC 1 cut(s) 396
Csp6I GTAC 1 cut(s) 90
CviAII CATG 1 cut(s) 431
CviJI RGCY 7 cut(s) 58, 101, 136, 223, 267, 330, 376
CviKI_1 RGCY 7 cut(s) 58, 101, 136, 223, 267, 330, 376
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 3 cut(s) 166, 272, 372
DpnI GATC 2 cut(s) 382, 459
DpnII GATC 2 cut(s) 380, 457
DrdI GACNNNNNNGTC 1 cut(s) 293
DseDI GACNNNNNNGTC 1 cut(s) 293
Eco130I CCWWGG 1 cut(s) 102
Eco32I GATATC 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 129
EcoRV GATATC 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaeI CATG 1 cut(s) 434
FatI CATG 1 cut(s) 430
FspBI CTAG 1 cut(s) 93
GsuI CTGGAG 3 cut(s) 50, 152, 318
Hin1II CATG 1 cut(s) 434
HindIII AAGCTT 1 cut(s) 56
HinfI GANTC 3 cut(s) 287, 418, 470
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 3 cut(s) 153, 273, 344
Hpy188III TCNNGA 1 cut(s) 216
HpyAV CCTTC 1 cut(s) 448
HpyCH4V TGCA 3 cut(s) 29, 302, 414
HpyF10VI GCNNNNNNNGC 1 cut(s) 404
HpyF3I CTNAG 3 cut(s) 166, 272, 372
Hsp92II CATG 1 cut(s) 434
Kzo9I GATC 2 cut(s) 380, 457
LmnI GCTCC 2 cut(s) 133, 147
LweI GCATC 3 cut(s) 221, 416, 485
MaeI CTAG 1 cut(s) 93
MalI GATC 2 cut(s) 382, 459
MboI GATC 2 cut(s) 380, 457
MboII GAAGA 1 cut(s) 460
MfeI CAATTG 1 cut(s) 78
MflI RGATCY 2 cut(s) 380, 457
MluCI AATT 2 cut(s) 7, 78
MlyI GAGTC 1 cut(s) 281
MmeI TCCRAC 1 cut(s) 284
MnlI CCTC 3 cut(s) 135, 175, 342
MseI TTAA 2 cut(s) 60, 347
MspR9I CCNGG 1 cut(s) 131
MunI CAATTG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 1 cut(s) 404
NdeII GATC 2 cut(s) 380, 457
NlaIII CATG 1 cut(s) 434
NlaIV GGNNCC 1 cut(s) 459
PfeI GAWTC 2 cut(s) 418, 470
PleI GAGTC 1 cut(s) 281
PpsI GAGTC 1 cut(s) 281
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PspN4I GGNNCC 1 cut(s) 459
PsrI GAACNNNNNNTAC 2 cut(s) 344, 376
PsuI RGATCY 2 cut(s) 380, 457
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
SaqAI TTAA 2 cut(s) 60, 347
Sau3AI GATC 2 cut(s) 380, 457
ScaI AGTACT 1 cut(s) 91
SchI GAGTC 1 cut(s) 281
ScrFI CCNGG 1 cut(s) 131
SetI ASST 8 cut(s) 60, 132, 138, 183, 225, 353, 378, 403
SfaNI GCATC 3 cut(s) 221, 416, 485
SfcI CTRYAG 1 cut(s) 402
Sse9I AATT 2 cut(s) 7, 78
SspI AATATT 1 cut(s) 22
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 129
StyI CCWWGG 1 cut(s) 102
TasI AATT 2 cut(s) 7, 78
TatI WGTACW 1 cut(s) 89
TfiI GAWTC 2 cut(s) 418, 470
Tru1I TTAA 2 cut(s) 60, 347
Tru9I TTAA 2 cut(s) 60, 347
TscAI CASTG 1 cut(s) 304
TspDTI ATGAA 3 cut(s) 378, 452, 467
TspRI CASTG 1 cut(s) 304
XspI CTAG 1 cut(s) 93
ZrmI AGTACT 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.