Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8265537.1

Orthogroup ID

OG0008132

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 634

Gene Structure 634 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8265537.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 505 bp

agaagtccagacttcaagtgatgatgatgttgaactgacagcagaagatttagtgatgattgctgaagagtacataaaagctgataggaaattagtgccagaaaaagcatcaaatcaagaatgtgaatcaggcagcagacttgcactaagagtcgcttccagtagtaagtcagatgattctatggactcccaaaactgtaacgcaagatcactcatccaagatgctaccagttctaagcctaacgggagctcgactagtgaagaaattgccttgaactccagtagaacaggggatcctgctcaggacatgctggatctgtttttaggcccctggctgaagaaacctgtcgagaaggaagcgaggtctgacattttgacagacgatctggcattttcctacagaatcgaatcacaaactcatagtaatgttgttaaagaagaaattgcccccataacgaagaagaagaccagtctgaaagacaaggtggcaatgtttcttgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

167

Amino Acids

18.38

Weight (kDa)

4.62

Isoelectric Point (pI)

50.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008132)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g36500 FvH4_4g36500
malus_domestica	MD13G1008600.v1.1
prunus_persica	Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1 Prupe.1G344100_v2.0.a1
pyrus_communis	pycom13g00720
rosa_chinensis	RchiOBHm_Chr4g0446261
rosa_laevigata	RLG00000005676
rosa_multiflora	Rmu_co8265537.1_g000001 Rmu_sc0022410.1_g000001
rosa_roxburghii	Rroxscaffold_5G00386660
rosa_rugosa	Rorug04G0369100 Rorug04G0369200 Rorug04G0369300
rosa_samantha	Rh4AG431100 Rh4BG440500 Rh4CG457800 Rh4DG439000
rosa_wichuraiana	Rw4G036830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	288, 301, 322
AcuI	CTGAAG	2 cut(s)	85, 357
AfaI	GTAC	1 cut(s)	72
AgsI	TTSAA	3 cut(s)	16, 33, 275
AhlI	ACTAGT	1 cut(s)	255
AjnI	CCWGG	1 cut(s)	330
AloI	GAACNNNNNNTCC	2 cut(s)	278, 310
AluBI	AGCT	2 cut(s)	81, 250
AluI	AGCT	2 cut(s)	81, 250
Alw21I	GWGCWC	1 cut(s)	252
AlwI	GGATC	3 cut(s)	288, 301, 322
AoxI	GGCC	1 cut(s)	326
ApeKI	GCWGC	1 cut(s)	133
AspS9I	GGNCC	1 cut(s)	327
BamHI	GGATCC	1 cut(s)	293
BanII	GRGCYC	1 cut(s)	252
BbsI	GAAGAC	1 cut(s)	471
Bbv12I	GWGCWC	1 cut(s)	252
BbvI	GCAGC	1 cut(s)	145
BciT130I	CCWGG	1 cut(s)	332
BcuI	ACTAGT	1 cut(s)	255
BfaI	CTAG	1 cut(s)	256
BfmI	CTRYAG	1 cut(s)	398
BisI	GCNGC	1 cut(s)	134
BlsI	GCNGC	1 cut(s)	135
Bme1390I	CCNGG	1 cut(s)	332
BmgT120I	GGNCC	1 cut(s)	327
BmiI	GGNNCC	2 cut(s)	295, 329
BmrFI	CCNGG	1 cut(s)	332
BmsI	GCATC	2 cut(s)	117, 212
BpiI	GAAGAC	1 cut(s)	471
BpmI	CTGGAG	1 cut(s)	263
Bpu10I	CCTNAGC	1 cut(s)	301
BsaJI	CCNNGG	1 cut(s)	330
Bse1I	ACTGG	4 cut(s)	160, 229, 280, 469
Bse3DI	GCAATG	1 cut(s)	496
BseBI	CCWGG	1 cut(s)	332
BseDI	CCNNGG	1 cut(s)	330
BseGI	GGATG	1 cut(s)	214
BseMI	GCAATG	1 cut(s)	496
BseMII	CTCAG	1 cut(s)	315
BseNI	ACTGG	4 cut(s)	160, 229, 280, 469
BseXI	GCAGC	1 cut(s)	145
BshFI	GGCC	1 cut(s)	328
BsiHKAI	GWGCWC	1 cut(s)	252
BsnI	GGCC	1 cut(s)	328
Bsp1286I	GDGCHC	1 cut(s)	252
Bsp143I	GATC	4 cut(s)	207, 293, 314, 383
BspANI	GGCC	1 cut(s)	328
BspCNI	CTCAG	1 cut(s)	314
BspLI	GGNNCC	2 cut(s)	295, 329
BspPI	GGATC	3 cut(s)	288, 301, 322
BsrDI	GCAATG	1 cut(s)	496
BsrI	ACTGG	4 cut(s)	160, 229, 280, 469
BssECI	CCNNGG	1 cut(s)	330
BssMI	GATC	4 cut(s)	207, 293, 314, 383
Bst2UI	CCWGG	1 cut(s)	332
Bst4CI	ACNGT	1 cut(s)	198
Bst6I	CTCTTC	1 cut(s)	61
BstDEI	CTNAG	3 cut(s)	147, 235, 301
BstF5I	GGATG	1 cut(s)	214
BstKTI	GATC	4 cut(s)	210, 296, 317, 386
BstMBI	GATC	4 cut(s)	207, 293, 314, 383
BstNI	CCWGG	1 cut(s)	332
BstNSI	RCATGY	1 cut(s)	311
BstSCI	CCNGG	1 cut(s)	330
BstSFI	CTRYAG	1 cut(s)	398
BstV1I	GCAGC	1 cut(s)	145
BstV2I	GAAGAC	1 cut(s)	471
BstX2I	RGATCY	2 cut(s)	293, 314
BstYI	RGATCY	2 cut(s)	293, 314
BsuRI	GGCC	1 cut(s)	328
BtsCI	GGATG	1 cut(s)	214
Cfr13I	GGNCC	1 cut(s)	327
Csp6I	GTAC	1 cut(s)	71
CviAII	CATG	1 cut(s)	308
CviJI	RGCY	5 cut(s)	81, 239, 250, 328, 335
CviKI_1	RGCY	5 cut(s)	81, 239, 250, 328, 335
CviQI	GTAC	1 cut(s)	71
DdeI	CTNAG	3 cut(s)	147, 235, 301
DpnI	GATC	4 cut(s)	209, 295, 316, 385
DpnII	GATC	4 cut(s)	207, 293, 314, 383
Eam1104I	CTCTTC	1 cut(s)	61
EarI	CTCTTC	1 cut(s)	61
Ecl136II	GAGCTC	1 cut(s)	250
Eco24I	GRGCYC	1 cut(s)	252
Eco53kI	GAGCTC	1 cut(s)	250
Eco57I	CTGAAG	2 cut(s)	85, 357
EcoICRI	GAGCTC	1 cut(s)	250
EcoO109I	RGGNCCY	1 cut(s)	327
EcoRII	CCWGG	1 cut(s)	330
EcoT38I	GRGCYC	1 cut(s)	252
FaeI	CATG	1 cut(s)	311
FaiI	YATR	5 cut(s)	75, 183, 309, 421, 453
FalI	AAGNNNNNCTT	2 cut(s)	140, 172
FatI	CATG	1 cut(s)	307
Fnu4HI	GCNGC	1 cut(s)	134
FokI	GGATG	1 cut(s)	201
FriOI	GRGCYC	1 cut(s)	252
Fsp4HI	GCNGC	1 cut(s)	134
FspBI	CTAG	1 cut(s)	256
GluI	GCNGC	1 cut(s)	134
GsuI	CTGGAG	1 cut(s)	263
HaeIII	GGCC	1 cut(s)	328
Hin1II	CATG	1 cut(s)	311
HinfI	GANTC	6 cut(s)	126, 151, 177, 186, 403, 408
Hpy188I	TCNGA	3 cut(s)	173, 368, 475
Hpy188III	TCNNGA	5 cut(s)	8, 117, 303, 350, 498
HpyAV	CCTTC	1 cut(s)	347
HpyCH4III	ACNGT	1 cut(s)	198
HpyCH4V	TGCA	1 cut(s)	144
HpyF3I	CTNAG	3 cut(s)	147, 235, 301
Hsp92II	CATG	1 cut(s)	311
Kzo9I	GATC	4 cut(s)	207, 293, 314, 383
LmnI	GCTCC	1 cut(s)	247
Lsp1109I	GCAGC	1 cut(s)	145
LweI	GCATC	2 cut(s)	117, 212
MaeI	CTAG	1 cut(s)	256
MaeIII	GTNAC	1 cut(s)	198
MalI	GATC	4 cut(s)	209, 295, 316, 385
MboI	GATC	4 cut(s)	207, 293, 314, 383
MboII	GAAGA	8 cut(s)	57, 78, 273, 350, 450, 470, 473, 476
MflI	RGATCY	2 cut(s)	293, 314
MhlI	GDGCHC	1 cut(s)	252
MluCI	AATT	3 cut(s)	90, 265, 442
MlyI	GAGTC	2 cut(s)	160, 180
MnlI	CCTC	1 cut(s)	355
MseI	TTAA	1 cut(s)	433
MslI	CAYNNNNRTG	1 cut(s)	424
MspR9I	CCNGG	1 cut(s)	332
MvaI	CCWGG	1 cut(s)	332
NdeII	GATC	4 cut(s)	207, 293, 314, 383
NlaIII	CATG	1 cut(s)	311
NlaIV	GGNNCC	2 cut(s)	295, 329
NspI	RCATGY	1 cut(s)	311
PfeI	GAWTC	4 cut(s)	126, 177, 403, 408
PkrI	GCNGC	1 cut(s)	135
PleI	GAGTC	2 cut(s)	159, 180
PpsI	GAGTC	2 cut(s)	159, 180
Psp124BI	GAGCTC	1 cut(s)	252
Psp6I	CCWGG	1 cut(s)	330
PspGI	CCWGG	1 cut(s)	330
PspN4I	GGNNCC	2 cut(s)	295, 329
PspPI	GGNCC	1 cut(s)	327
PsuI	RGATCY	2 cut(s)	293, 314
RsaI	GTAC	1 cut(s)	72
RsaNI	GTAC	1 cut(s)	71
RseI	CAYNNNNRTG	1 cut(s)	424
SacI	GAGCTC	1 cut(s)	252
SaqAI	TTAA	1 cut(s)	433
SatI	GCNGC	1 cut(s)	134
Sau3AI	GATC	4 cut(s)	207, 293, 314, 383
Sau96I	GGNCC	1 cut(s)	327
SchI	GAGTC	2 cut(s)	160, 180
ScrFI	CCNGG	1 cut(s)	332
SduI	GDGCHC	1 cut(s)	252
SetI	ASST	5 cut(s)	83, 252, 347, 366, 487
SfaNI	GCATC	2 cut(s)	117, 212
SfcI	CTRYAG	1 cut(s)	398
SmiMI	CAYNNNNRTG	1 cut(s)	424
SpeI	ACTAGT	1 cut(s)	255
Sse9I	AATT	3 cut(s)	90, 265, 442
SspMI	CTAG	1 cut(s)	256
SstI	GAGCTC	1 cut(s)	252
StyD4I	CCNGG	1 cut(s)	330
TaaI	ACNGT	1 cut(s)	198
TaqI	TCGA	3 cut(s)	252, 349, 406
TasI	AATT	3 cut(s)	90, 265, 442
TatI	WGTACW	1 cut(s)	70
TfiI	GAWTC	4 cut(s)	126, 177, 403, 408
Tru1I	TTAA	1 cut(s)	433
Tru9I	TTAA	1 cut(s)	433
TseI	GCWGC	1 cut(s)	133
XceI	RCATGY	1 cut(s)	311
XspI	CTAG	1 cut(s)	256

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.