Rmu_co8287351.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8287351.1
Physical Location & Seq
Reverse (-)
302 .. 646
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8287351.1_g000001.1.cds

Sequence Viewer

Length: 345 bp
atgaatgatggtagtttattgcagaccaatagttggcaatggaaattcaaggataattctattaacatatactatgaggagtatgaaaaggagagaaagggtccttgtaagaatatccttatgataccaacgatttctgatgttagcacagttgaagaatggagagcagtggcaagtaatattgttcagcaagttggtaatgttaattggcgagctactatcgtagattggcctggtctagggtactctgataggccaaagatggactacactgctgatgtgatggagaaatttctggtcgacttcatcaattcagttgatggtcctctaagtggctcaggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.01

Weight (kDa)

4.59

Isoelectric Point (pI)

20.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014291)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 33
AccI GTMKAC 1 cut(s) 300
AcsI RAATTY 2 cut(s) 44, 290
AfaI GTAC 1 cut(s) 245
AfiI CCNNNNNNNGG 3 cut(s) 33, 239, 332
AgsI TTSAA 2 cut(s) 49, 155
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AoxI GGCC 2 cut(s) 230, 254
ApoI RAATTY 2 cut(s) 44, 290
AspS9I GGNCC 2 cut(s) 101, 323
AvaII GGWCC 2 cut(s) 101, 323
BccI CCATC 4 cut(s) 2, 256, 277, 314
BciT130I CCWGG 1 cut(s) 234
BfaI CTAG 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 2 cut(s) 101, 323
BmgT120I GGNCC 2 cut(s) 101, 323
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 234
Bpu10I CCTNAGC 1 cut(s) 337
Bsc4I CCNNNNNNNGG 3 cut(s) 33, 239, 332
Bse3DI GCAATG 1 cut(s) 44
BseBI CCWGG 1 cut(s) 234
BseLI CCNNNNNNNGG 3 cut(s) 33, 239, 332
BseMI GCAATG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 92
BshFI GGCC 2 cut(s) 232, 256
BslI CCNNNNNNNGG 3 cut(s) 33, 239, 332
BsnI GGCC 2 cut(s) 232, 256
BspANI GGCC 2 cut(s) 232, 256
BspLI GGNNCC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 1 cut(s) 151
BstC8I GCNNGC 1 cut(s) 213
BstDEI CTNAG 2 cut(s) 329, 337
BstENI CCTNNNNNAGG 1 cut(s) 237
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BsuRI GGCC 2 cut(s) 232, 256
BtsI GCAGTG 2 cut(s) 174, 270
BtsIMutI CAGTG 2 cut(s) 174, 270
Cac8I GCNNGC 1 cut(s) 213
Cfr13I GGNCC 2 cut(s) 101, 323
Csp6I GTAC 1 cut(s) 244
CviJI RGCY 4 cut(s) 215, 232, 256, 336
CviKI_1 RGCY 4 cut(s) 215, 232, 256, 336
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 2 cut(s) 329, 337
Eco47I GGWCC 2 cut(s) 101, 323
EcoNI CCTNNNNNAGG 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 232
FaiI YATR 5 cut(s) 68, 70, 75, 84, 122
FblI GTMKAC 1 cut(s) 300
FspBI CTAG 1 cut(s) 239
HaeIII GGCC 2 cut(s) 232, 256
HincII GTYRAC 1 cut(s) 301
HindII GTYRAC 1 cut(s) 301
Hpy166II GTNNAC 1 cut(s) 301
Hpy188I TCNGA 2 cut(s) 139, 250
Hpy8I GTNNAC 1 cut(s) 301
HpyCH4III ACNGT 1 cut(s) 151
HpyCH4V TGCA 1 cut(s) 22
HpyF3I CTNAG 2 cut(s) 329, 337
LpnPI CCDG 4 cut(s) 219, 246, 281, 324
MaeI CTAG 1 cut(s) 239
MboII GAAGA 1 cut(s) 167
MluCI AATT 5 cut(s) 44, 55, 205, 290, 310
MnlI CCTC 2 cut(s) 70, 336
MseI TTAA 3 cut(s) 63, 204, 343
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
NlaIV GGNNCC 1 cut(s) 102
PflMI CCANNNNNTGG 1 cut(s) 33
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 2 cut(s) 101, 323
PspPPI RGGWCCY 1 cut(s) 101
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
SalI GTCGAC 1 cut(s) 299
SaqAI TTAA 3 cut(s) 63, 204, 343
Sau96I GGNCC 2 cut(s) 101, 323
ScrFI CCNGG 1 cut(s) 234
SetI ASST 2 cut(s) 217, 343
SgeI CNNG 9 cut(s) 61, 117, 186, 203, 224, 245, 246, 251, 308
SinI GGWCC 2 cut(s) 101, 323
Sse9I AATT 5 cut(s) 44, 55, 205, 290, 310
SspI AATATT 1 cut(s) 181
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 1 cut(s) 232
TaaI ACNGT 1 cut(s) 151
TaqI TCGA 1 cut(s) 300
TasI AATT 5 cut(s) 44, 55, 205, 290, 310
Tru1I TTAA 3 cut(s) 63, 204, 343
Tru9I TTAA 3 cut(s) 63, 204, 343
TscAI CASTG 2 cut(s) 174, 277
TspDTI ATGAA 3 cut(s) 17, 99, 295
TspRI CASTG 2 cut(s) 174, 277
Van91I CCANNNNNTGG 1 cut(s) 33
VpaK11BI GGWCC 2 cut(s) 101, 323
XagI CCTNNNNNAGG 1 cut(s) 237
XapI RAATTY 2 cut(s) 44, 290
XmiI GTMKAC 1 cut(s) 300
XspI CTAG 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.