Rmu_co8297867.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8297867.1
Physical Location & Seq
Forward (+)
1 .. 711
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8297867.1_g000001.1.cds

Sequence Viewer

Length: 401 bp
gaaggctgcgtcatccaaatcttgtgaaattgttgggttattgctttgaagatggtcatcggcttctggtgtttgaatttatgtctcgtggcggcttggataatcatatatttggaagggattcttgtcttcaaccactttcatggaacctgcgtatgaagatttcccttgaggctgctaatgttctagcatttcttcacaatggtgaggaaacagtagtccatcgggacattacaagttctaatatcctgttggattcaacttacaatgccaaactcgctgactttggtttagcaaaggatggacccacaggtgataaaagccatgtttcaacagcagtgatggggacacatgggtatgctgctcctgagtatattgctacaggtgtctctagtttatag
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.5

Weight (kDa)

6.39

Isoelectric Point (pI)

42.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017558)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07570
fragaria_vesca FvH4_3g36200 FvH4_3g36200 FvH4_3g36200
pyrus_communis pycom15g24140
rosa_chinensis RchiOBHm_Chr1g0367651
rosa_multiflora Rmu_co8297867.1_g000001
rosa_roxburghii Rroxscaffold_2G00138910
rosa_samantha Rh1AG343000 Rh1CG320100 Rh1DG336400 Rh5DG453400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 158
AciI CCGC 1 cut(s) 92
AcsI RAATTY 1 cut(s) 76
AgsI TTSAA 5 cut(s) 49, 76, 133, 260, 332
AleI CACNNNNGTG 1 cut(s) 203
Alw26I GTCTC 2 cut(s) 89, 393
ApeKI GCWGC 3 cut(s) 6, 175, 361
ApoI RAATTY 1 cut(s) 76
Asp700I GAANNNNTTC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 304
AsuHPI GGTGA 2 cut(s) 217, 325
AvaII GGWCC 1 cut(s) 304
BauI CACGAG 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 121
BbvI GCAGC 2 cut(s) 162, 348
BccI CCATC 4 cut(s) 46, 230, 295, 336
BcoDI GTCTC 2 cut(s) 89, 393
BfaI CTAG 2 cut(s) 187, 392
BfmI CTRYAG 1 cut(s) 380
BfuAI ACCTGC 1 cut(s) 158
BisI GCNGC 4 cut(s) 7, 93, 176, 362
BlsI GCNGC 4 cut(s) 8, 94, 177, 363
Bme18I GGWCC 1 cut(s) 304
BmgT120I GGNCC 1 cut(s) 304
BmiI GGNNCC 2 cut(s) 148, 306
BpiI GAAGAC 1 cut(s) 121
BpuEI CTTGAG 1 cut(s) 190
BsaBI GATNNNNATC 1 cut(s) 56
Bse8I GATNNNNATC 1 cut(s) 56
BseGI GGATG 2 cut(s) 12, 306
BseJI GATNNNNATC 1 cut(s) 56
BseMII CTCAG 1 cut(s) 359
BseXI GCAGC 2 cut(s) 162, 348
BslFI GGGAC 2 cut(s) 241, 360
BsmAI GTCTC 2 cut(s) 89, 393
BsmFI GGGAC 2 cut(s) 241, 360
BspACI CCGC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 360
BspLI GGNNCC 2 cut(s) 148, 306
BspMI ACCTGC 1 cut(s) 158
BssSI CACGAG 1 cut(s) 86
Bst2BI CACGAG 1 cut(s) 86
Bst4CI ACNGT 1 cut(s) 216
BstDEI CTNAG 1 cut(s) 368
BstF5I GGATG 2 cut(s) 12, 306
BstMAI GTCTC 2 cut(s) 89, 393
BstMWI GCNNNNNNNGC 1 cut(s) 277
BstSFI CTRYAG 1 cut(s) 380
BstV1I GCAGC 2 cut(s) 162, 348
BstV2I GAAGAC 1 cut(s) 121
BstXI CCANNNNNNTGG 1 cut(s) 143
BtsCI GGATG 2 cut(s) 12, 306
BtsI GCAGTG 1 cut(s) 344
BtsIMutI CAGTG 1 cut(s) 344
BveI ACCTGC 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 304
CviAII CATG 3 cut(s) 143, 325, 352
CviJI RGCY 5 cut(s) 6, 63, 95, 175, 323
CviKI_1 RGCY 5 cut(s) 6, 63, 95, 175, 323
DdeI CTNAG 1 cut(s) 368
Eco47I GGWCC 1 cut(s) 304
FaeI CATG 3 cut(s) 146, 328, 355
FalI AAGNNNNNCTT 2 cut(s) 108, 140
FaqI GGGAC 2 cut(s) 241, 360
FatI CATG 3 cut(s) 142, 324, 351
Fnu4HI GCNGC 4 cut(s) 7, 93, 176, 362
FokI GGATG 1 cut(s) 313
Fsp4HI GCNGC 4 cut(s) 7, 93, 176, 362
FspBI CTAG 2 cut(s) 187, 392
GluI GCNGC 4 cut(s) 7, 93, 176, 362
Hin1II CATG 3 cut(s) 146, 328, 355
HinfI GANTC 2 cut(s) 121, 256
HphI GGTGA 2 cut(s) 217, 325
Hpy188III TCNNGA 2 cut(s) 226, 367
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 216
HpyF10VI GCNNNNNNNGC 1 cut(s) 277
HpyF3I CTNAG 1 cut(s) 368
Hsp92II CATG 3 cut(s) 146, 328, 355
LmnI GCTCC 1 cut(s) 369
LpnPI CCDG 6 cut(s) 52, 163, 262, 296, 368, 380
Lsp1109I GCAGC 2 cut(s) 162, 348
MaeI CTAG 2 cut(s) 187, 392
MboII GAAGA 4 cut(s) 61, 121, 171, 187
MluCI AATT 2 cut(s) 28, 76
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 2 cut(s) 165, 201
MroXI GAANNNNTTC 1 cut(s) 120
MslI CAYNNNNRTG 3 cut(s) 141, 203, 356
MwoI GCNNNNNNNGC 1 cut(s) 277
NlaIII CATG 3 cut(s) 146, 328, 355
NlaIV GGNNCC 2 cut(s) 148, 306
OliI CACNNNNGTG 1 cut(s) 203
PdmI GAANNNNTTC 1 cut(s) 120
PfeI GAWTC 2 cut(s) 121, 256
PkrI GCNGC 4 cut(s) 8, 94, 177, 363
PspN4I GGNNCC 2 cut(s) 148, 306
PspPI GGNCC 1 cut(s) 304
RseI CAYNNNNRTG 3 cut(s) 141, 203, 356
SatI GCNGC 4 cut(s) 7, 93, 176, 362
Sau96I GGNCC 1 cut(s) 304
SetI ASST 3 cut(s) 152, 315, 387
SfcI CTRYAG 1 cut(s) 380
SinI GGWCC 1 cut(s) 304
SmiMI CAYNNNNRTG 3 cut(s) 141, 203, 356
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
Sse9I AATT 2 cut(s) 28, 76
SsiI CCGC 1 cut(s) 92
SspMI CTAG 2 cut(s) 187, 392
TaaI ACNGT 1 cut(s) 216
TasI AATT 2 cut(s) 28, 76
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 2 cut(s) 121, 256
TscAI CASTG 1 cut(s) 344
TseI GCWGC 3 cut(s) 6, 175, 361
TspDTI ATGAA 2 cut(s) 131, 172
TspRI CASTG 1 cut(s) 344
VpaK11BI GGWCC 1 cut(s) 304
XapI RAATTY 1 cut(s) 76
XmnI GAANNNNTTC 1 cut(s) 120
XspI CTAG 2 cut(s) 187, 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.