Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8303565.1

Orthogroup ID

OG0012592

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 901

Gene Structure 901 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8303565.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 901 bp

ggttgtcccaagactcgagctttcggaaccatttgatcaatttctacgcaaaaagcaggttttttgggcatgcccggaagctgatcgacgaaagtcctgaaccagatttggttgcttggtctgctttgatttctgggtatgcccagaatgggcttggtagagaagcaatttcagcttttcatgagatgcatggattgggggtcaagtgtaatgagtttacattcccaagtgtgctcaaggcttgctcttattctaaagatttgaggctgggaaagcaggttcatggggtggtgttggttaccgggtttgagtccgatgagtttgttgctaatactctggttgttatgtattcgaaatgtggggagtttggggattccaggaggctgtttgatgcaattccggagaggaatgttgtttcgtggaatgcgttgttttcgtgttatgtgcagagtgatttctttggggaggcaatggatttgtttgaggaaatggttgtgagtggaataaggcctaatgagtatagtctgtctagtataataaatgcttgtactggattgggggatggtagaagaggaaggaaaattcatggatatatagttaagcttgggtatgattctgattctttctcagccaatgcgcttgttgacatgtatgcaaaagccaaaggtcttgaagatgcaatttcagtttttgagaaaattgcacaaccagatattgtatcctggaatgctgttattgctggttgtgttcttcacaactgccatggtcgggcgctcaaattgttcaggcaactgagagggtcaggaatccgtcctaatatgtttacattatcaagtgcgcttaaagcttgtgctgggatgggtttcgagaaattgggtaggcagttgcactctttcttgat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

299

Amino Acids

33.04

Weight (kDa)

7.73

Isoelectric Point (pI)

42.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012592)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g08720 FvH4_7g02630
malus_domestica	MD10G1290200.v1.1
prunus_persica	Prupe.4G051600_v2.0.a1
pyrus_communis	pycom05g28730 pycom10g24240
rosa_chinensis	RchiOBHm_Chr5g0009041
rosa_laevigata	RLG00000031625
rosa_multiflora	Rmu_co8303565.1_g000001 Rmu_sc0002034.1_g000012 Rmu_sc0039526.1_g000001
rosa_roxburghii	Rroxscaffold_1G00066980
rosa_rugosa	Rorug04G0440900
rosa_samantha	Rh5AG069900 Rh5BG066600 Rh5BG066800 Rh5CG078000 Rh5DG066100
rosa_wichuraiana	Rw5G006530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	47, 267
AccIII	TCCGGA	1 cut(s)	399
AcsI	RAATTY	1 cut(s)	581
AfaI	GTAC	1 cut(s)	549
AfiI	CCNNNNNNNGG	2 cut(s)	149, 768
AflIII	ACRYGT	1 cut(s)	647
AgsI	TTSAA	1 cut(s)	673
AjnI	CCWGG	2 cut(s)	376, 721
AloI	GAACNNNNNNTCC	2 cut(s)	263, 295
AluBI	AGCT	5 cut(s)	20, 81, 175, 603, 847
AluI	AGCT	5 cut(s)	20, 81, 175, 603, 847
Alw21I	GWGCWC	1 cut(s)	236
Ama87I	CYCGRG	1 cut(s)	15
Aor13HI	TCCGGA	1 cut(s)	399
AoxI	GGCC	1 cut(s)	508
ApoI	RAATTY	1 cut(s)	581
AspLEI	GCGC	3 cut(s)	639, 774, 840
AsuC2I	CCSGG	2 cut(s)	75, 303
AsuII	TTCGAA	1 cut(s)	352
AvaI	CYCGRG	1 cut(s)	15
Bbv12I	GWGCWC	1 cut(s)	236
BccI	CCATC	2 cut(s)	556, 852
BciT130I	CCWGG	2 cut(s)	378, 723
BciVI	GTATCC	1 cut(s)	729
BclI	TGATCA	1 cut(s)	35
BcnI	CCSGG	2 cut(s)	75, 303
BfaI	CTAG	1 cut(s)	530
BfoI	RGCGCY	1 cut(s)	775
BfuAI	ACCTGC	2 cut(s)	47, 267
BfuI	GTATCC	1 cut(s)	729
Bme1390I	CCNGG	4 cut(s)	75, 303, 378, 723
BmeT110I	CYCGRG	1 cut(s)	15
BmiI	GGNNCC	1 cut(s)	28
BmrFI	CCNGG	4 cut(s)	75, 303, 378, 723
BmsI	GCATC	3 cut(s)	176, 381, 666
BoxI	GACNNNNGTC	1 cut(s)	92
Bpu14I	TTCGAA	1 cut(s)	352
BpuEI	CTTGAG	1 cut(s)	220
BpuMI	CCSGG	2 cut(s)	75, 303
BsaJI	CCNNGG	1 cut(s)	762
BsaWI	WCCGGW	1 cut(s)	399
Bsc4I	CCNNNNNNNGG	2 cut(s)	149, 768
Bse1I	ACTGG	1 cut(s)	555
Bse3DI	GCAATG	1 cut(s)	476
BseAI	TCCGGA	1 cut(s)	399
BseBI	CCWGG	2 cut(s)	378, 723
BseDI	CCNNGG	1 cut(s)	762
BseGI	GGATG	2 cut(s)	567, 863
BseLI	CCNNNNNNNGG	2 cut(s)	149, 768
BseMI	GCAATG	1 cut(s)	476
BseMII	CTCAG	2 cut(s)	641, 784
BseNI	ACTGG	1 cut(s)	555
BseYI	CCCAGC	2 cut(s)	267, 853
BsgI	GTGCAG	1 cut(s)	466
BshFI	GGCC	1 cut(s)	510
BsiHKAI	GWGCWC	1 cut(s)	236
BsiHKCI	CYCGRG	1 cut(s)	15
BsiSI	CCGG	3 cut(s)	75, 302, 400
BslI	CCNNNNNNNGG	2 cut(s)	149, 768
BsmI	GAATGC	2 cut(s)	429, 732
BsnI	GGCC	1 cut(s)	510
BsoBI	CYCGRG	1 cut(s)	15
Bsp119I	TTCGAA	1 cut(s)	352
Bsp1286I	GDGCHC	1 cut(s)	236
Bsp13I	TCCGGA	1 cut(s)	399
Bsp143I	GATC	2 cut(s)	35, 83
Bsp19I	CCATGG	1 cut(s)	762
BspANI	GGCC	1 cut(s)	510
BspCNI	CTCAG	2 cut(s)	640, 785
BspEI	TCCGGA	1 cut(s)	399
BspHI	TCATGA	1 cut(s)	180
BspLI	GGNNCC	1 cut(s)	28
BspMI	ACCTGC	2 cut(s)	47, 267
BspT104I	TTCGAA	1 cut(s)	352
BsrDI	GCAATG	1 cut(s)	476
BsrI	ACTGG	1 cut(s)	555
BssECI	CCNNGG	1 cut(s)	762
BssMI	GATC	2 cut(s)	35, 83
BssT1I	CCWWGG	1 cut(s)	762
Bst2UI	CCWGG	2 cut(s)	378, 723
Bst6I	CTCTTC	1 cut(s)	564
BstBI	TTCGAA	1 cut(s)	352
BstC8I	GCNNGC	2 cut(s)	71, 243
BstDEI	CTNAG	2 cut(s)	627, 793
BstDSI	CCRYGG	1 cut(s)	762
BstEII	GGTNACC	1 cut(s)	297
BstF5I	GGATG	2 cut(s)	567, 863
BstH2I	RGCGCY	1 cut(s)	775
BstHHI	GCGC	3 cut(s)	639, 774, 840
BstKTI	GATC	2 cut(s)	38, 86
BstMBI	GATC	2 cut(s)	35, 83
BstMWI	GCNNNNNNNGC	5 cut(s)	121, 172, 273, 736, 844
BstNI	CCWGG	2 cut(s)	378, 723
BstNSI	RCATGY	2 cut(s)	73, 651
BstPAI	GACNNNNGTC	1 cut(s)	92
BstPI	GGTNACC	1 cut(s)	297
BstSCI	CCNGG	4 cut(s)	73, 301, 376, 721
BsuI	GTATCC	1 cut(s)	729
BsuRI	GGCC	1 cut(s)	510
BtgI	CCRYGG	1 cut(s)	762
BtsCI	GGATG	2 cut(s)	567, 863
BveI	ACCTGC	2 cut(s)	47, 267
Cac8I	GCNNGC	2 cut(s)	71, 243
CciI	TCATGA	1 cut(s)	180
CfoI	GCGC	3 cut(s)	639, 774, 840
Csp6I	GTAC	1 cut(s)	548
CviAII	CATG	7 cut(s)	70, 181, 190, 283, 586, 648, 763
CviQI	GTAC	1 cut(s)	548
DdeI	CTNAG	2 cut(s)	627, 793
DpnI	GATC	2 cut(s)	37, 85
DpnII	GATC	2 cut(s)	35, 83
Eam1104I	CTCTTC	1 cut(s)	564
EarI	CTCTTC	1 cut(s)	564
Eco130I	CCWWGG	1 cut(s)	762
Eco147I	AGGCCT	1 cut(s)	510
Eco88I	CYCGRG	1 cut(s)	15
Eco91I	GGTNACC	1 cut(s)	297
EcoO65I	GGTNACC	1 cut(s)	297
EcoRII	CCWGG	2 cut(s)	376, 721
EcoT14I	CCWWGG	1 cut(s)	762
EcoT22I	ATGCAT	1 cut(s)	191
ErhI	CCWWGG	1 cut(s)	762
FaeI	CATG	7 cut(s)	73, 184, 193, 286, 589, 651, 766
FatI	CATG	7 cut(s)	69, 180, 189, 282, 585, 647, 762
FbaI	TGATCA	1 cut(s)	35
FokI	GGATG	2 cut(s)	574, 870
FspBI	CTAG	1 cut(s)	530
GlaI	GCGC	3 cut(s)	638, 773, 839
GsaI	CCCAGC	2 cut(s)	271, 857
HaeII	RGCGCY	1 cut(s)	775
HaeIII	GGCC	1 cut(s)	510
HapII	CCGG	3 cut(s)	75, 302, 400
HhaI	GCGC	3 cut(s)	639, 774, 840
Hin1II	CATG	7 cut(s)	73, 184, 193, 286, 589, 651, 766
Hin6I	GCGC	3 cut(s)	637, 772, 838
HinP1I	GCGC	3 cut(s)	637, 772, 838
HincII	GTYRAC	1 cut(s)	645
HindII	GTYRAC	1 cut(s)	645
HindIII	AAGCTT	2 cut(s)	601, 845
HinfI	GANTC	6 cut(s)	13, 310, 373, 613, 619, 806
HpaII	CCGG	3 cut(s)	75, 302, 400
Hpy166II	GTNNAC	3 cut(s)	218, 645, 824
Hpy188I	TCNGA	3 cut(s)	26, 315, 618
Hpy188III	TCNNGA	7 cut(s)	97, 181, 400, 670, 803, 867, 897
Hpy8I	GTNNAC	3 cut(s)	218, 645, 824
Hpy99I	CGWCG	1 cut(s)	91
HpyAV	CCTTC	1 cut(s)	569
HpyCH4V	TGCA	7 cut(s)	189, 394, 447, 655, 679, 703, 888
HpyF10VI	GCNNNNNNNGC	5 cut(s)	121, 172, 273, 736, 844
HpyF3I	CTNAG	2 cut(s)	627, 793
Hsp92II	CATG	7 cut(s)	73, 184, 193, 286, 589, 651, 766
HspAI	GCGC	3 cut(s)	637, 772, 838
Kpn2I	TCCGGA	1 cut(s)	399
Ksp22I	TGATCA	1 cut(s)	35
Kzo9I	GATC	2 cut(s)	35, 83
LweI	GCATC	3 cut(s)	176, 381, 666
MaeI	CTAG	1 cut(s)	530
MaeIII	GTNAC	1 cut(s)	297
MalI	GATC	2 cut(s)	37, 85
MboI	GATC	2 cut(s)	35, 83
MboII	GAAGA	3 cut(s)	581, 685, 742
MhlI	GDGCHC	1 cut(s)	236
MluCI	AATT	8 cut(s)	39, 167, 395, 581, 680, 698, 778, 871
MlyI	GAGTC	2 cut(s)	7, 319
MnlI	CCTC	7 cut(s)	257, 374, 398, 459, 477, 565, 790
Mph1103I	ATGCAT	1 cut(s)	191
MroI	TCCGGA	1 cut(s)	399
MseI	TTAA	2 cut(s)	599, 842
MspI	CCGG	3 cut(s)	75, 302, 400
MspR9I	CCNGG	4 cut(s)	75, 303, 378, 723
Mva1269I	GAATGC	2 cut(s)	429, 732
MvaI	CCWGG	2 cut(s)	378, 723
MwoI	GCNNNNNNNGC	5 cut(s)	121, 172, 273, 736, 844
NciI	CCSGG	2 cut(s)	75, 303
NcoI	CCATGG	1 cut(s)	762
NdeII	GATC	2 cut(s)	35, 83
NlaIII	CATG	7 cut(s)	73, 184, 193, 286, 589, 651, 766
NlaIV	GGNNCC	1 cut(s)	28
NsiI	ATGCAT	1 cut(s)	191
NspI	RCATGY	2 cut(s)	73, 651
NspV	TTCGAA	1 cut(s)	352
PaeI	GCATGC	1 cut(s)	73
PaeR7I	CTCGAG	1 cut(s)	15
PagI	TCATGA	1 cut(s)	180
PceI	AGGCCT	1 cut(s)	510
PciI	ACATGT	1 cut(s)	647
PcsI	WCGNNNNNNNCGW	1 cut(s)	424
PctI	GAATGC	2 cut(s)	429, 732
PfeI	GAWTC	4 cut(s)	373, 613, 619, 806
PfoI	TCCNGGA	2 cut(s)	376, 721
PleI	GAGTC	2 cut(s)	7, 318
PpsI	GAGTC	2 cut(s)	7, 318
PscI	ACATGT	1 cut(s)	647
PshAI	GACNNNNGTC	1 cut(s)	92
Psp6I	CCWGG	2 cut(s)	376, 721
PspEI	GGTNACC	1 cut(s)	297
PspFI	CCCAGC	2 cut(s)	267, 853
PspGI	CCWGG	2 cut(s)	376, 721
PspN4I	GGNNCC	1 cut(s)	28
PspXI	VCTCGAGB	1 cut(s)	15
RsaI	GTAC	1 cut(s)	549
RsaNI	GTAC	1 cut(s)	548
SaqAI	TTAA	2 cut(s)	599, 842
Sau3AI	GATC	2 cut(s)	35, 83
SchI	GAGTC	2 cut(s)	7, 319
ScrFI	CCNGG	4 cut(s)	75, 303, 378, 723
SduI	GDGCHC	1 cut(s)	236
SetI	ASST	8 cut(s)	22, 61, 83, 177, 281, 605, 669, 849
SfaNI	GCATC	3 cut(s)	176, 381, 666
Sfr274I	CTCGAG	1 cut(s)	15
SfuI	TTCGAA	1 cut(s)	352
SlaI	CTCGAG	1 cut(s)	15
SmlI	CTYRAG	2 cut(s)	15, 235
SmoI	CTYRAG	2 cut(s)	15, 235
SphI	GCATGC	1 cut(s)	73
Sse9I	AATT	8 cut(s)	39, 167, 395, 581, 680, 698, 778, 871
SseBI	AGGCCT	1 cut(s)	510
SspMI	CTAG	1 cut(s)	530
StuI	AGGCCT	1 cut(s)	510
StyD4I	CCNGG	4 cut(s)	73, 301, 376, 721
StyI	CCWWGG	1 cut(s)	762
TaqI	TCGA	4 cut(s)	16, 86, 352, 866
TasI	AATT	8 cut(s)	39, 167, 395, 581, 680, 698, 778, 871
TatI	WGTACW	1 cut(s)	547
TfiI	GAWTC	4 cut(s)	373, 613, 619, 806
Tru1I	TTAA	2 cut(s)	599, 842
Tru9I	TTAA	2 cut(s)	599, 842
TspDTI	ATGAA	3 cut(s)	169, 271, 574
TspGWI	ACGGA	1 cut(s)	799
XapI	RAATTY	1 cut(s)	581
XceI	RCATGY	2 cut(s)	73, 651
XcmI	CCANNNNNNNNNTGG	1 cut(s)	151
XhoI	CTCGAG	1 cut(s)	15
XspI	CTAG	1 cut(s)	530
Zsp2I	ATGCAT	1 cut(s)	191

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.