Rmu_co8348189.1_g000001

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8348189.1
Physical Location & Seq
Reverse (-)
41 .. 812
772 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8348189.1_g000001.1.cds

Sequence Viewer

Length: 201 bp
atgggtcggaaggctgccggagaagaaccgcttcctgaagaggatccttcaaaccccattttcaagccactccccgagccttcacggttggacagctttctgataacaaatcaaatctcaaactactgcaaccaaattaatggggttgccggacagagcttcggcagattatatttgacgaaggctttgcatgagaactga

Protein Analysis

66

Amino Acids

7.32

Weight (kDa)

5.16

Isoelectric Point (pI)

46.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011440)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AclWI GGATC 2 cut(s) 38, 51
AcuI CTGAAG 1 cut(s) 57
AgsI TTSAA 2 cut(s) 51, 64
AluBI AGCT 2 cut(s) 96, 159
AluI AGCT 2 cut(s) 96, 159
AlwI GGATC 2 cut(s) 38, 51
Ama87I CYCGRG 1 cut(s) 74
ApeKI GCWGC 1 cut(s) 14
ArsI GACNNNNNNTTYG 2 cut(s) 169, 201
AseI ATTAAT 1 cut(s) 138
Asp700I GAANNNNTTC 1 cut(s) 30
AvaI CYCGRG 1 cut(s) 74
BamHI GGATCC 1 cut(s) 43
BcgI CGANNNNNNTGC 1 cut(s) 169
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BmeT110I CYCGRG 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 45
BsiHKCI CYCGRG 1 cut(s) 74
BsiSI CCGG 2 cut(s) 18, 150
BsoBI CYCGRG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 43
BspACI CCGC 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 2 cut(s) 38, 51
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 87
Bst6I CTCTTC 1 cut(s) 33
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 43
BstXI CCANNNNNNTGG 1 cut(s) 140
BstYI RGATCY 1 cut(s) 43
CviAII CATG 1 cut(s) 191
CviJI RGCY 6 cut(s) 14, 67, 79, 96, 159, 185
CviKI_1 RGCY 6 cut(s) 14, 67, 79, 96, 159, 185
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
Eco57I CTGAAG 1 cut(s) 57
Eco88I CYCGRG 1 cut(s) 74
FaeI CATG 1 cut(s) 194
FaiI YATR 2 cut(s) 172, 192
FalI AAGNNNNNCTT 2 cut(s) 15, 47
FatI CATG 1 cut(s) 190
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HapII CCGG 2 cut(s) 18, 150
Hin1II CATG 1 cut(s) 194
HpaII CCGG 2 cut(s) 18, 150
Hpy188I TCNGA 2 cut(s) 9, 102
Hpy188III TCNNGA 1 cut(s) 35
HpyAV CCTTC 4 cut(s) 4, 57, 90, 175
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 2 cut(s) 129, 190
Hsp92II CATG 1 cut(s) 194
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 3 cut(s) 31, 48, 163
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 35, 50
MflI RGATCY 1 cut(s) 43
MluCI AATT 1 cut(s) 135
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 1 cut(s) 34
MroXI GAANNNNTTC 1 cut(s) 30
MseI TTAA 1 cut(s) 138
MspI CCGG 2 cut(s) 18, 150
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 194
NlaIV GGNNCC 1 cut(s) 45
PdmI GAANNNNTTC 1 cut(s) 30
PkrI GCNGC 1 cut(s) 16
PshBI ATTAAT 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 45
PsuI RGATCY 1 cut(s) 43
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 1 cut(s) 43
SetI ASST 2 cut(s) 98, 161
SgeI CNNG 7 cut(s) 30, 47, 76, 86, 88, 96, 162
Sse9I AATT 1 cut(s) 135
SsiI CCGC 1 cut(s) 29
TaaI ACNGT 1 cut(s) 87
TasI AATT 1 cut(s) 135
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseI GCWGC 1 cut(s) 14
VspI ATTAAT 1 cut(s) 138
XmnI GAANNNNTTC 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.