Rmu_co8348491.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8348491.1
Physical Location & Seq
Reverse (-)
1 .. 590
590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8348491.1_g000001.1.cds

Sequence Viewer

Length: 225 bp
atgttactcatgtggaactccagaattgaaataaatggcggtggaaataccattgttacttcttcagttcttgaagttaggaatctcattgaaatgaggcataagtctgtcattagttcaaataaaaacttgggtgtttatggtcaaggactactgaagttgactgatcatggtgatacaataaaagcccagcgtctttctttgtctctcttttataacataact
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.36

Weight (kDa)

9.69

Isoelectric Point (pI)

41.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 216
AciI CCGC 1 cut(s) 39
AcuI CTGAAG 2 cut(s) 48, 176
AgsI TTSAA 4 cut(s) 29, 74, 92, 120
Alw26I GTCTC 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 185
BclI TGATCA 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 210
BpmI CTGGAG 1 cut(s) 4
BseYI CCCAGC 1 cut(s) 189
BsmAI GTCTC 1 cut(s) 210
Bsp143I GATC 1 cut(s) 166
BspACI CCGC 1 cut(s) 39
BssMI GATC 1 cut(s) 166
BstKTI GATC 1 cut(s) 169
BstMAI GTCTC 1 cut(s) 210
BstMBI GATC 1 cut(s) 166
CseI GACGC 1 cut(s) 182
CviAII CATG 2 cut(s) 10, 170
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco57I CTGAAG 2 cut(s) 48, 176
FaeI CATG 2 cut(s) 13, 173
FaiI YATR 6 cut(s) 11, 102, 141, 171, 216, 221
FatI CATG 2 cut(s) 9, 169
FbaI TGATCA 1 cut(s) 166
GsaI CCCAGC 1 cut(s) 193
GsuI CTGGAG 1 cut(s) 4
HgaI GACGC 1 cut(s) 182
Hin1II CATG 2 cut(s) 13, 173
HincII GTYRAC 1 cut(s) 162
HindII GTYRAC 1 cut(s) 162
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 185
Hpy166II GTNNAC 1 cut(s) 162
Hpy188III TCNNGA 2 cut(s) 21, 71
Hpy8I GTNNAC 1 cut(s) 162
Hsp92II CATG 2 cut(s) 13, 173
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 2 cut(s) 34, 203
MaeIII GTNAC 2 cut(s) 3, 55
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 54
MluCI AATT 1 cut(s) 24
MnlI CCTC 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 92
NdeII GATC 1 cut(s) 166
NlaIII CATG 2 cut(s) 13, 173
PfeI GAWTC 1 cut(s) 82
PsiI TTATAA 1 cut(s) 216
PspFI CCCAGC 1 cut(s) 189
RseI CAYNNNNRTG 1 cut(s) 92
Sau3AI GATC 1 cut(s) 166
SgeI CNNG 7 cut(s) 22, 33, 83, 142, 158, 182, 202
SmiMI CAYNNNNRTG 1 cut(s) 92
Sse9I AATT 1 cut(s) 24
SsiI CCGC 1 cut(s) 39
TasI AATT 1 cut(s) 24
TfiI GAWTC 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.