Rmu_co8350293.1_g000001

Exportin 1-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8350293.1
Physical Location & Seq
Reverse (-)
1 .. 923
923 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8350293.1_g000001.1.cds

Sequence Viewer

Length: 455 bp
atgtctgaaattgcaaatcctaatgaagagtgggctttgaaaagtcagacagcagcacttgttgctgagatagttagaagtgaaggagtagatctctggcaggaactgcttccaactctggtttccttatctgcaaagggtcctatacaagctgagttggtctccatgatgctgaggtggcttcctgaagacattactgttcacaatgaagatttggaagctgatcggagaaggctattgttgcgtgggctgaccctatccttacctgaaattttacctctattatacaacttactagagaggcattttggagctgccatgagtgaagcagggaaacaacaagtggaccttgcaaaacaacatgcatctgcagtaacagctactttaaatgctgttaatgcatattctgaatgggctccattgcctgatcttgctaaatatggtataattcatgg

Protein Analysis

152

Amino Acids

16.79

Weight (kDa)

4.92

Isoelectric Point (pI)

55.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 270
AcuI CTGAAG 1 cut(s) 207
AgsI TTSAA 1 cut(s) 40
AjuI GAANNNNNNNTTGG 2 cut(s) 106, 138
AluBI AGCT 4 cut(s) 152, 221, 314, 380
AluI AGCT 4 cut(s) 152, 221, 314, 380
Alw26I GTCTC 1 cut(s) 166
AlwNI CAGNNNCTG 1 cut(s) 106
ApeKI GCWGC 2 cut(s) 53, 314
ApoI RAATTY 1 cut(s) 270
Asp700I GAANNNNTTC 1 cut(s) 108
AspS9I GGNCC 2 cut(s) 140, 346
AvaII GGWCC 2 cut(s) 140, 346
BanII GRGCYC 1 cut(s) 418
BbsI GAAGAC 1 cut(s) 195
BbvCI CCTCAGC 1 cut(s) 173
BbvI GCAGC 2 cut(s) 65, 301
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 1 cut(s) 296
BfmI CTRYAG 1 cut(s) 369
BglII AGATCT 1 cut(s) 91
BisI GCNGC 2 cut(s) 54, 315
BlsI GCNGC 2 cut(s) 55, 316
Bme18I GGWCC 2 cut(s) 140, 346
BmgT120I GGNCC 2 cut(s) 140, 346
BmiI GGNNCC 2 cut(s) 141, 417
BmsI GCATC 2 cut(s) 159, 374
BpiI GAAGAC 1 cut(s) 195
BplI GAGNNNNNCTC 4 cut(s) 78, 110, 146, 178
Bpu10I CCTNAGC 1 cut(s) 173
BsaI GGTCTC 1 cut(s) 166
Bse3DI GCAATG 1 cut(s) 419
BseMI GCAATG 1 cut(s) 419
BseMII CTCAG 3 cut(s) 57, 144, 164
BseXI GCAGC 2 cut(s) 65, 301
BsmAI GTCTC 1 cut(s) 166
Bso31I GGTCTC 1 cut(s) 166
Bsp1286I GDGCHC 1 cut(s) 418
Bsp143I GATC 3 cut(s) 91, 223, 427
BspCNI CTCAG 3 cut(s) 58, 145, 165
BspLI GGNNCC 2 cut(s) 141, 417
BspMAI CTGCAG 1 cut(s) 373
BspTNI GGTCTC 1 cut(s) 166
BsrDI GCAATG 1 cut(s) 419
BssMI GATC 3 cut(s) 91, 223, 427
Bst4CI ACNGT 1 cut(s) 199
Bst6I CTCTTC 1 cut(s) 21
BstAPI GCANNNNNTGC 2 cut(s) 62, 106
BstDEI CTNAG 3 cut(s) 66, 153, 173
BstKTI GATC 3 cut(s) 94, 226, 430
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 3 cut(s) 91, 223, 427
BstMWI GCNNNNNNNGC 6 cut(s) 62, 106, 178, 241, 377, 398
BstNSI RCATGY 1 cut(s) 365
BstSFI CTRYAG 1 cut(s) 369
BstV1I GCAGC 2 cut(s) 65, 301
BstV2I GAAGAC 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
CaiI CAGNNNCTG 1 cut(s) 106
Cfr13I GGNCC 2 cut(s) 140, 346
CviAII CATG 4 cut(s) 166, 319, 362, 452
CviJI RGCY 9 cut(s) 35, 152, 181, 221, 235, 250, 314, 380, 416
CviKI_1 RGCY 9 cut(s) 35, 152, 181, 221, 235, 250, 314, 380, 416
DdeI CTNAG 3 cut(s) 66, 153, 173
DpnI GATC 3 cut(s) 93, 225, 429
DpnII GATC 3 cut(s) 91, 223, 427
DraI TTTAAA 1 cut(s) 387
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Eco24I GRGCYC 1 cut(s) 418
Eco31I GGTCTC 1 cut(s) 166
Eco47I GGWCC 2 cut(s) 140, 346
Eco57I CTGAAG 1 cut(s) 207
EcoO109I RGGNCCY 1 cut(s) 140
EcoT22I ATGCAT 2 cut(s) 367, 403
EcoT38I GRGCYC 1 cut(s) 418
FaeI CATG 4 cut(s) 169, 322, 365, 455
FaiI YATR 9 cut(s) 146, 167, 286, 320, 363, 403, 441, 446, 453
FalI AAGNNNNNCTT 2 cut(s) 333, 365
FatI CATG 4 cut(s) 165, 318, 361, 451
Fnu4HI GCNGC 2 cut(s) 54, 315
FriOI GRGCYC 1 cut(s) 418
Fsp4HI GCNGC 2 cut(s) 54, 315
FspBI CTAG 1 cut(s) 296
GluI GCNGC 2 cut(s) 54, 315
Hin1II CATG 4 cut(s) 169, 322, 365, 455
Hpy166II GTNNAC 2 cut(s) 202, 346
Hpy188I TCNGA 4 cut(s) 7, 48, 228, 409
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 2 cut(s) 202, 346
HpyAV CCTTC 2 cut(s) 77, 225
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 6 cut(s) 14, 134, 353, 365, 371, 401
HpyF10VI GCNNNNNNNGC 6 cut(s) 62, 106, 178, 241, 377, 398
HpyF3I CTNAG 3 cut(s) 66, 153, 173
Hsp92II CATG 4 cut(s) 169, 322, 365, 455
Kzo9I GATC 3 cut(s) 91, 223, 427
LmnI GCTCC 2 cut(s) 311, 421
LpnPI CCDG 7 cut(s) 82, 86, 104, 198, 279, 315, 438
Lsp1109I GCAGC 2 cut(s) 65, 301
LweI GCATC 2 cut(s) 159, 374
MaeI CTAG 1 cut(s) 296
MaeIII GTNAC 1 cut(s) 373
MalI GATC 3 cut(s) 93, 225, 429
MboI GATC 3 cut(s) 91, 223, 427
MboII GAAGA 3 cut(s) 38, 200, 221
MflI RGATCY 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 418
MluCI AATT 3 cut(s) 9, 270, 447
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 3 cut(s) 168, 288, 294
Mph1103I ATGCAT 2 cut(s) 367, 403
MroXI GAANNNNTTC 1 cut(s) 108
MseI TTAA 2 cut(s) 386, 396
MwoI GCNNNNNNNGC 6 cut(s) 62, 106, 178, 241, 377, 398
NdeII GATC 3 cut(s) 91, 223, 427
NlaIII CATG 4 cut(s) 169, 322, 365, 455
NlaIV GGNNCC 2 cut(s) 141, 417
NsiI ATGCAT 2 cut(s) 367, 403
NspI RCATGY 1 cut(s) 365
PdmI GAANNNNTTC 1 cut(s) 108
PkrI GCNGC 2 cut(s) 55, 316
PpuMI RGGWCCY 1 cut(s) 140
Psp5II RGGWCCY 1 cut(s) 140
PspN4I GGNNCC 2 cut(s) 141, 417
PspPI GGNCC 2 cut(s) 140, 346
PspPPI RGGWCCY 1 cut(s) 140
PstI CTGCAG 1 cut(s) 373
PstNI CAGNNNCTG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 91
SaqAI TTAA 2 cut(s) 386, 396
SatI GCNGC 2 cut(s) 54, 315
Sau3AI GATC 3 cut(s) 91, 223, 427
Sau96I GGNCC 2 cut(s) 140, 346
SduI GDGCHC 1 cut(s) 418
SetI ASST 8 cut(s) 154, 179, 223, 268, 280, 316, 351, 382
SfaNI GCATC 2 cut(s) 159, 374
SfcI CTRYAG 1 cut(s) 369
SinI GGWCC 2 cut(s) 140, 346
Sse9I AATT 3 cut(s) 9, 270, 447
SspMI CTAG 1 cut(s) 296
TaaI ACNGT 1 cut(s) 199
TasI AATT 3 cut(s) 9, 270, 447
Tru1I TTAA 2 cut(s) 386, 396
Tru9I TTAA 2 cut(s) 386, 396
TseI GCWGC 2 cut(s) 53, 314
TspDTI ATGAA 3 cut(s) 39, 222, 440
VpaK11BI GGWCC 2 cut(s) 140, 346
XapI RAATTY 1 cut(s) 270
XceI RCATGY 1 cut(s) 365
XmnI GAANNNNTTC 1 cut(s) 108
XspI CTAG 1 cut(s) 296
Zsp2I ATGCAT 2 cut(s) 367, 403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.