Rmu_co8418867.1_g000001

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8418867.1
Physical Location & Seq
Reverse (-)
1 .. 1142
1142 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8418867.1_g000001.1.cds

Sequence Viewer

Length: 190 bp
atggagcttaggctgtgcaaacagcagatttcagggttagaaaaggcgtataaagatgagaagcacaggcttggtttggctgaagaagagttgcaatcgatgagatatcaccctttacgagatcataggccactgagttcaggggacgctcaatgtactagcaaaagcaaaaagttgaaaagatgtaagg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.38

Weight (kDa)

9.51

Isoelectric Point (pI)

56.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 102
AfaI GTAC 1 cut(s) 157
AgsI TTSAA 1 cut(s) 178
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
AoxI GGCC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 101
BfaI CTAG 1 cut(s) 159
Bpu10I CCTNAGC 1 cut(s) 8
Bsa29I ATCGAT 1 cut(s) 98
BseCI ATCGAT 1 cut(s) 98
BseMII CTCAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 130
BshVI ATCGAT 1 cut(s) 98
BslFI GGGAC 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 158
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 121
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 126
BspDI ATCGAT 1 cut(s) 98
BssMI GATC 1 cut(s) 121
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 8, 134
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
Bsu15I ATCGAT 1 cut(s) 98
BsuRI GGCC 1 cut(s) 130
BsuTUI ATCGAT 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 131
ClaI ATCGAT 1 cut(s) 98
CseI GACGC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 156
CviJI RGCY 5 cut(s) 7, 13, 70, 80, 130
CviKI_1 RGCY 5 cut(s) 7, 13, 70, 80, 130
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 2 cut(s) 8, 134
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco32I GATATC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 102
EcoRV GATATC 1 cut(s) 107
FaiI YATR 2 cut(s) 51, 126
FaqI GGGAC 1 cut(s) 158
FspBI CTAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 130
HgaI GACGC 1 cut(s) 155
HphI GGTGA 1 cut(s) 101
HpyCH4V TGCA 2 cut(s) 18, 94
HpyF3I CTNAG 2 cut(s) 8, 134
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 18, 52, 126
MaeI CTAG 1 cut(s) 159
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 2 cut(s) 95, 98
NdeII GATC 1 cut(s) 121
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
Sau3AI GATC 1 cut(s) 121
SetI ASST 1 cut(s) 9
SgeI CNNG 6 cut(s) 45, 79, 83, 131, 153, 171
SspMI CTAG 1 cut(s) 159
TaqI TCGA 1 cut(s) 98
TatI WGTACW 1 cut(s) 155
TscAI CASTG 1 cut(s) 138
TspRI CASTG 1 cut(s) 138
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.