Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8448729.1

Orthogroup ID

OG0008122

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1658

Gene Structure 1657 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8448729.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 813 bp

atgaactcagcatctattaatgtaaggcgctgtcctaattcattgaatgtggttgagaaagattctgctggtggtgtagactggaggaatgaaactgagacttcagttgctgcaagttctgccactacccagtctccccactctgtggaatttgagcatcatgggcctatacatgagattaggatatctgattctcacagtatagacagttatgaagagtgcaaccaatctagcccaaacacgaagaggaaaagagcattgagaaatattgatagtgatgggtgtaagcgctgcaactgcaggaagaccaaatgcttgaaactttattgtgattgtttttctgctggaatctattgtgacacaacttgtgcttgccaagagtgctttaacagacccgagtatgaagatacggttcttgagacaagacaaaaaatagaatcccgtaaccctcttgcatttgctcccaaggttgtagagcgtgaagatgagaatcaattcacaccagcctcggcaagacataaaagagggtgcaattgcaaaaagtcaatgtgtctgaaaaaatattgtgaatgttatcaggctaatgtaggatgctccaatggatgccggtgtgaaggatgtcaaaatgcttatggcaagaggggagagtttgttgacgtggattctagtgtgtccgaagaagtgattactgacaaagatggcacagaaataagagaaagcacatttgatgagaagctgcaaatggtggcaacaaggaaagattcaaatgattcacccagcctcactccgttgacaccatcattgcaatgcttt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04218 map04218

Pfam Domains

Protein Families

TCR

Protein Analysis

271

Amino Acids

30.36

Weight (kDa)

5.94

Isoelectric Point (pI)

57.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008122)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g29570 FvH4_2g29570 FvH4_2g29570
malus_domestica	MD08G1145800.v1.1 MD15G1121200.v1.1
prunus_persica	Prupe.1G473800_v2.0.a1 Prupe.1G473800_v2.0.a1 Prupe.1G473800_v2.0.a1
pyrus_communis	pycom08g12270 pycom15g10940
rosa_chinensis	RchiOBHm_Chr6g0298531
rosa_multiflora	Rmu_co8315197.1_g000001 Rmu_co8448729.1_g000001 Rmu_sc0004500.1_g000005 Rmu_ssc0000289.1_g000056
rosa_roxburghii	Rroxscaffold_7G00169560
rosa_rugosa	Rorug06G0281000 Rorug06G0281000
rosa_samantha	Rh6AG392300 Rh6BG400100 Rh6CG406000 Rh6DG392400 Rh6DG392500
rosa_wichuraiana	Rw6G034290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	145
AccI	GTMKAC	1 cut(s)	78
AcsI	RAATTY	1 cut(s)	149
AcuI	CTGAAG	1 cut(s)	87
AdeI	CACNNNGTG	1 cut(s)	145
AfeI	AGCGCT	1 cut(s)	290
AfiI	CCNNNNNNNGG	1 cut(s)	145
AgsI	TTSAA	3 cut(s)	46, 319, 765
AjiI	CACGTC	1 cut(s)	658
AluBI	AGCT	1 cut(s)	736
AluI	AGCT	1 cut(s)	736
Alw26I	GTCTC	3 cut(s)	92, 138, 413
AlwNI	CAGNNNCTG	1 cut(s)	110
Ama87I	CYCGRG	1 cut(s)	395
Aor51HI	AGCGCT	1 cut(s)	290
AoxI	GGCC	1 cut(s)	164
ApeKI	GCWGC	3 cut(s)	110, 291, 736
ApoI	RAATTY	1 cut(s)	149
AseI	ATTAAT	1 cut(s)	18
Asp700I	GAANNNNTTC	1 cut(s)	494
AspLEI	GCGC	2 cut(s)	30, 291
AspS9I	GGNCC	1 cut(s)	164
AsuHPI	GGTGA	1 cut(s)	765
AvaI	CYCGRG	1 cut(s)	395
BbsI	GAAGAC	1 cut(s)	311
BbvI	GCAGC	3 cut(s)	97, 278, 723
BccI	CCATC	3 cut(s)	272, 692, 805
BcoDI	GTCTC	3 cut(s)	92, 138, 413
BfaI	CTAG	2 cut(s)	231, 666
BfmI	CTRYAG	1 cut(s)	298
BfoI	RGCGCY	2 cut(s)	31, 292
BisI	GCNGC	3 cut(s)	111, 292, 737
BlsI	GCNGC	3 cut(s)	112, 293, 738
BmeT110I	CYCGRG	1 cut(s)	395
BmgBI	CACGTC	1 cut(s)	658
BmgT120I	GGNCC	1 cut(s)	164
BmrI	ACTGGG	1 cut(s)	124
BmsI	GCATC	4 cut(s)	20, 166, 581, 593
BmuI	ACTGGG	1 cut(s)	124
BpiI	GAAGAC	1 cut(s)	311
BpmI	CTGGAG	1 cut(s)	103
BpuEI	CTTGAG	1 cut(s)	437
BsaBI	GATNNNNATC	1 cut(s)	489
BsaJI	CCNNGG	2 cut(s)	465, 507
BsaXI	ACNNNNNCTCC	4 cut(s)	118, 148, 636, 666
Bsc4I	CCNNNNNNNGG	1 cut(s)	145
Bse118I	RCCGGY	1 cut(s)	606
Bse1I	ACTGG	2 cut(s)	86, 130
Bse3DI	GCAATG	2 cut(s)	800, 812
Bse8I	GATNNNNATC	1 cut(s)	489
BseDI	CCNNGG	2 cut(s)	465, 507
BseGI	GGATG	3 cut(s)	596, 608, 623
BseJI	GATNNNNATC	1 cut(s)	489
BseLI	CCNNNNNNNGG	1 cut(s)	145
BseMI	GCAATG	2 cut(s)	800, 812
BseMII	CTCAG	2 cut(s)	21, 87
BseNI	ACTGG	2 cut(s)	86, 130
BseXI	GCAGC	3 cut(s)	97, 278, 723
BseYI	CCCAGC	1 cut(s)	776
BshFI	GGCC	1 cut(s)	166
BsiHKCI	CYCGRG	1 cut(s)	395
BsiSI	CCGG	1 cut(s)	607
BslI	CCNNNNNNNGG	1 cut(s)	145
BsmAI	GTCTC	3 cut(s)	92, 138, 413
BsnI	GGCC	1 cut(s)	166
BsoBI	CYCGRG	1 cut(s)	395
BspANI	GGCC	1 cut(s)	166
BspCNI	CTCAG	2 cut(s)	20, 88
BspMAI	CTGCAG	1 cut(s)	302
BsrDI	GCAATG	2 cut(s)	800, 812
BsrFI	RCCGGY	1 cut(s)	606
BsrI	ACTGG	2 cut(s)	86, 130
BssAI	RCCGGY	1 cut(s)	606
BssECI	CCNNGG	2 cut(s)	465, 507
BssT1I	CCWWGG	1 cut(s)	465
Bst4CI	ACNGT	3 cut(s)	200, 209, 412
Bst6I	CTCTTC	2 cut(s)	210, 239
BstAPI	GCANNNNNTGC	1 cut(s)	119
BstC8I	GCNNGC	1 cut(s)	373
BstDEI	CTNAG	2 cut(s)	7, 96
BstF5I	GGATG	3 cut(s)	596, 608, 623
BstH2I	RGCGCY	2 cut(s)	31, 292
BstHHI	GCGC	2 cut(s)	30, 291
BstMAI	GTCTC	3 cut(s)	92, 138, 413
BstMWI	GCNNNNNNNGC	4 cut(s)	119, 163, 297, 381
BstSFI	CTRYAG	1 cut(s)	298
BstV1I	GCAGC	3 cut(s)	97, 278, 723
BstV2I	GAAGAC	1 cut(s)	311
BsuRI	GGCC	1 cut(s)	166
BtrI	CACGTC	1 cut(s)	658
BtsCI	GGATG	3 cut(s)	596, 608, 623
Cac8I	GCNNGC	1 cut(s)	373
CaiI	CAGNNNCTG	1 cut(s)	110
CfoI	GCGC	2 cut(s)	30, 291
Cfr10I	RCCGGY	1 cut(s)	606
Cfr13I	GGNCC	1 cut(s)	164
CviAII	CATG	2 cut(s)	161, 173
CviJI	RGCY	6 cut(s)	166, 234, 506, 581, 736, 780
CviKI_1	RGCY	6 cut(s)	166, 234, 506, 581, 736, 780
DdeI	CTNAG	2 cut(s)	7, 96
DraIII	CACNNNGTG	1 cut(s)	145
Eam1104I	CTCTTC	2 cut(s)	210, 239
EarI	CTCTTC	2 cut(s)	210, 239
Eco130I	CCWWGG	1 cut(s)	465
Eco32I	GATATC	1 cut(s)	186
Eco47III	AGCGCT	1 cut(s)	290
Eco57I	CTGAAG	1 cut(s)	87
Eco88I	CYCGRG	1 cut(s)	395
EcoRV	GATATC	1 cut(s)	186
EcoT14I	CCWWGG	1 cut(s)	465
ErhI	CCWWGG	1 cut(s)	465
FaeI	CATG	2 cut(s)	164, 176
FaiI	YATR	8 cut(s)	162, 170, 174, 203, 213, 402, 519, 633
FatI	CATG	2 cut(s)	160, 172
FblI	GTMKAC	1 cut(s)	78
Fnu4HI	GCNGC	3 cut(s)	111, 292, 737
FokI	GGATG	3 cut(s)	603, 615, 630
Fsp4HI	GCNGC	3 cut(s)	111, 292, 737
FspBI	CTAG	2 cut(s)	231, 666
GlaI	GCGC	2 cut(s)	29, 290
GluI	GCNGC	3 cut(s)	111, 292, 737
GsaI	CCCAGC	1 cut(s)	780
GsuI	CTGGAG	1 cut(s)	103
HaeII	RGCGCY	2 cut(s)	31, 292
HaeIII	GGCC	1 cut(s)	166
HapII	CCGG	1 cut(s)	607
HhaI	GCGC	2 cut(s)	30, 291
Hin1II	CATG	2 cut(s)	164, 176
Hin6I	GCGC	2 cut(s)	28, 289
HinP1I	GCGC	2 cut(s)	28, 289
HincII	GTYRAC	2 cut(s)	655, 792
HindII	GTYRAC	2 cut(s)	655, 792
HinfI	GANTC	8 cut(s)	62, 191, 348, 437, 490, 662, 761, 770
HpaII	CCGG	1 cut(s)	607
HphI	GGTGA	1 cut(s)	765
Hpy166II	GTNNAC	3 cut(s)	79, 655, 792
Hpy188I	TCNGA	3 cut(s)	190, 555, 676
Hpy188III	TCNNGA	1 cut(s)	416
Hpy8I	GTNNAC	3 cut(s)	79, 655, 792
HpyAV	CCTTC	1 cut(s)	608
HpyCH4III	ACNGT	3 cut(s)	200, 209, 412
HpyCH4IV	ACGT	1 cut(s)	657
HpyCH4V	TGCA	9 cut(s)	113, 222, 294, 300, 455, 531, 537, 739, 805
HpyF10VI	GCNNNNNNNGC	4 cut(s)	119, 163, 297, 381
HpyF3I	CTNAG	2 cut(s)	7, 96
HpySE526I	ACGT	1 cut(s)	657
Hsp92II	CATG	2 cut(s)	164, 176
HspAI	GCGC	2 cut(s)	28, 289
LmnI	GCTCC	2 cut(s)	466, 599
LpnPI	CCDG	9 cut(s)	54, 67, 143, 286, 330, 516, 563, 620, 790
Lsp1109I	GCAGC	3 cut(s)	97, 278, 723
LweI	GCATC	4 cut(s)	20, 166, 581, 593
MaeI	CTAG	2 cut(s)	231, 666
MaeII	ACGT	1 cut(s)	657
MaeIII	GTNAC	2 cut(s)	356, 443
MboII	GAAGA	6 cut(s)	227, 256, 316, 416, 494, 689
MfeI	CAATTG	1 cut(s)	532
MluCI	AATT	4 cut(s)	37, 149, 494, 532
MnlI	CCTC	7 cut(s)	78, 240, 459, 517, 518, 633, 791
MroXI	GAANNNNTTC	1 cut(s)	494
MseI	TTAA	2 cut(s)	18, 387
MslI	CAYNNNNRTG	1 cut(s)	805
MspI	CCGG	1 cut(s)	607
MunI	CAATTG	1 cut(s)	532
MwoI	GCNNNNNNNGC	4 cut(s)	119, 163, 297, 381
NlaIII	CATG	2 cut(s)	164, 176
NmeAIII	GCCGAG	1 cut(s)	488
NmuCI	GTSAC	1 cut(s)	356
PdmI	GAANNNNTTC	1 cut(s)	494
PfeI	GAWTC	8 cut(s)	62, 191, 348, 437, 490, 662, 761, 770
PflMI	CCANNNNNTGG	1 cut(s)	145
PkrI	GCNGC	3 cut(s)	112, 293, 738
PshBI	ATTAAT	1 cut(s)	18
PspFI	CCCAGC	1 cut(s)	776
PspPI	GGNCC	1 cut(s)	164
PstI	CTGCAG	1 cut(s)	302
PstNI	CAGNNNCTG	1 cut(s)	110
RseI	CAYNNNNRTG	1 cut(s)	805
SaqAI	TTAA	2 cut(s)	18, 387
SatI	GCNGC	3 cut(s)	111, 292, 737
Sau96I	GGNCC	1 cut(s)	164
SetI	ASST	3 cut(s)	471, 660, 738
SfaNI	GCATC	4 cut(s)	20, 166, 581, 593
SfcI	CTRYAG	1 cut(s)	298
SmiMI	CAYNNNNRTG	1 cut(s)	805
SmlI	CTYRAG	1 cut(s)	416
SmoI	CTYRAG	1 cut(s)	416
Sse9I	AATT	4 cut(s)	37, 149, 494, 532
SspI	AATATT	2 cut(s)	268, 563
SspMI	CTAG	2 cut(s)	231, 666
StyI	CCWWGG	1 cut(s)	465
TaaI	ACNGT	3 cut(s)	200, 209, 412
TaiI	ACGT	1 cut(s)	660
TasI	AATT	4 cut(s)	37, 149, 494, 532
TfiI	GAWTC	8 cut(s)	62, 191, 348, 437, 490, 662, 761, 770
Tru1I	TTAA	2 cut(s)	18, 387
Tru9I	TTAA	2 cut(s)	18, 387
TseFI	GTSAC	1 cut(s)	356
TseI	GCWGC	3 cut(s)	110, 291, 736
Tsp45I	GTSAC	1 cut(s)	356
TspDTI	ATGAA	5 cut(s)	17, 30, 105, 228, 417
TspGWI	ACGGA	1 cut(s)	777
Van91I	CCANNNNNTGG	1 cut(s)	145
VspI	ATTAAT	1 cut(s)	18
XapI	RAATTY	1 cut(s)	149
XmiI	GTMKAC	1 cut(s)	78
XmnI	GAANNNNTTC	1 cut(s)	494
XspI	CTAG	2 cut(s)	231, 666

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.