Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8457507.1

Orthogroup ID

OG0010819

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1168

Gene Structure 1168 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8457507.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 296 bp

aggagcagaggaaggcggttgagaaaaggattgaggacatggaggatgcggagaacgctagtgagggagaccaatctactgtgctgagtgataagatgtatgggaagtcaaacgctgatcaagtcaaggagcaagaagctgaggaattggataataatggttcgcaggcctcaagtataaacaatctgaatttagatctgggcttgcaaggtcacagtgtcaacctggaattaatgaacaaaatgaaagaggctcagacgaaaactgcaagctcaggtgggttttggttgcagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

97

Amino Acids

10.7

Weight (kDa)

4.46

Isoelectric Point (pI)

58.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010819)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55210
fragaria_vesca	FvH4_3g23530 FvH4_3g23530 FvH4_3g23530
malus_domestica	MD03G1193400.v1.1 MD11G1209600.v1.1
prunus_persica	Prupe.4G223100_v2.0.a1
pyrus_communis	pycom11g18510
rosa_chinensis	RchiOBHm_Chr5g0041531
rosa_laevigata	RLG00000034076
rosa_multiflora	Rmu_co8457507.1_g000001 Rmu_sc0014067.1_g000008 Rmu_sc0021997.1_g000002 Rmu_sc0029151.1_g000002
rosa_roxburghii	Rroxscaffold_1G00039000
rosa_rugosa	Rorug05G0193400
rosa_samantha	Rh5AG278900 Rh5BG283300 Rh5CG316200
rosa_wichuraiana	Rw5G026270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	16, 49
AcsI	RAATTY	1 cut(s)	189
AjnI	CCWGG	1 cut(s)	224
AluBI	AGCT	2 cut(s)	139, 272
AluI	AGCT	2 cut(s)	139, 272
Alw26I	GTCTC	1 cut(s)	62
AoxI	GGCC	1 cut(s)	167
ApoI	RAATTY	1 cut(s)	189
AseI	ATTAAT	1 cut(s)	232
BbvCI	CCTCAGC	1 cut(s)	140
BciT130I	CCWGG	1 cut(s)	226
BclI	TGATCA	1 cut(s)	117
BcoDI	GTCTC	1 cut(s)	62
BfaI	CTAG	1 cut(s)	59
BglII	AGATCT	1 cut(s)	195
Bme1390I	CCNGG	1 cut(s)	226
BmrFI	CCNGG	1 cut(s)	226
BmsI	GCATC	1 cut(s)	36
Bpu10I	CCTNAGC	2 cut(s)	140, 273
BpuEI	CTTGAG	1 cut(s)	156
BsaI	GGTCTC	1 cut(s)	62
BseBI	CCWGG	1 cut(s)	226
BseGI	GGATG	1 cut(s)	51
BseMII	CTCAG	4 cut(s)	76, 131, 268, 287
BshFI	GGCC	1 cut(s)	169
BsmAI	GTCTC	1 cut(s)	62
BsnI	GGCC	1 cut(s)	169
Bso31I	GGTCTC	1 cut(s)	62
Bsp143I	GATC	2 cut(s)	117, 195
BspACI	CCGC	2 cut(s)	16, 49
BspANI	GGCC	1 cut(s)	169
BspCNI	CTCAG	4 cut(s)	77, 132, 267, 286
BspTNI	GGTCTC	1 cut(s)	62
BssMI	GATC	2 cut(s)	117, 195
Bst2UI	CCWGG	1 cut(s)	226
Bst4CI	ACNGT	2 cut(s)	81, 217
BstC8I	GCNNGC	3 cut(s)	167, 205, 270
BstDEI	CTNAG	4 cut(s)	85, 140, 254, 273
BstF5I	GGATG	1 cut(s)	51
BstKTI	GATC	2 cut(s)	120, 198
BstMAI	GTCTC	1 cut(s)	62
BstMBI	GATC	2 cut(s)	117, 195
BstMWI	GCNNNNNNNGC	1 cut(s)	55
BstNI	CCWGG	1 cut(s)	226
BstSCI	CCNGG	1 cut(s)	224
BstX2I	RGATCY	1 cut(s)	195
BstYI	RGATCY	1 cut(s)	195
BsuRI	GGCC	1 cut(s)	169
BtsCI	GGATG	1 cut(s)	51
BtsIMutI	CAGTG	1 cut(s)	222
Cac8I	GCNNGC	3 cut(s)	167, 205, 270
CviAII	CATG	1 cut(s)	39
CviJI	RGCY	5 cut(s)	139, 169, 203, 253, 272
CviKI_1	RGCY	5 cut(s)	139, 169, 203, 253, 272
DdeI	CTNAG	4 cut(s)	85, 140, 254, 273
DpnI	GATC	2 cut(s)	119, 197
DpnII	GATC	2 cut(s)	117, 195
Eco147I	AGGCCT	1 cut(s)	169
Eco31I	GGTCTC	1 cut(s)	62
EcoRII	CCWGG	1 cut(s)	224
FaeI	CATG	1 cut(s)	42
FaiI	YATR	3 cut(s)	40, 101, 178
FatI	CATG	1 cut(s)	38
FbaI	TGATCA	1 cut(s)	117
FokI	GGATG	1 cut(s)	58
FspBI	CTAG	1 cut(s)	59
HaeIII	GGCC	1 cut(s)	169
Hin1II	CATG	1 cut(s)	42
HincII	GTYRAC	1 cut(s)	222
HindII	GTYRAC	1 cut(s)	222
Hpy166II	GTNNAC	1 cut(s)	222
Hpy188I	TCNGA	2 cut(s)	188, 257
Hpy8I	GTNNAC	1 cut(s)	222
HpyAV	CCTTC	1 cut(s)	6
HpyCH4III	ACNGT	2 cut(s)	81, 217
HpyCH4V	TGCA	3 cut(s)	207, 268, 291
HpyF10VI	GCNNNNNNNGC	1 cut(s)	55
HpyF3I	CTNAG	4 cut(s)	85, 140, 254, 273
Hsp92II	CATG	1 cut(s)	42
Ksp22I	TGATCA	1 cut(s)	117
Kzo9I	GATC	2 cut(s)	117, 195
LmnI	GCTCC	1 cut(s)	129
LpnPI	CCDG	5 cut(s)	151, 184, 211, 238, 260
LweI	GCATC	1 cut(s)	36
MaeI	CTAG	1 cut(s)	59
MaeIII	GTNAC	1 cut(s)	211
MalI	GATC	2 cut(s)	119, 197
MboI	GATC	2 cut(s)	117, 195
MflI	RGATCY	1 cut(s)	195
MluCI	AATT	3 cut(s)	145, 189, 229
MnlI	CCTC	6 cut(s)	27, 36, 57, 135, 180, 243
MseI	TTAA	1 cut(s)	232
MspR9I	CCNGG	1 cut(s)	226
MvaI	CCWGG	1 cut(s)	226
MwoI	GCNNNNNNNGC	1 cut(s)	55
NdeII	GATC	2 cut(s)	117, 195
NlaIII	CATG	1 cut(s)	42
NmuCI	GTSAC	1 cut(s)	211
PceI	AGGCCT	1 cut(s)	169
PshBI	ATTAAT	1 cut(s)	232
Psp6I	CCWGG	1 cut(s)	224
PspGI	CCWGG	1 cut(s)	224
PsuI	RGATCY	1 cut(s)	195
SaqAI	TTAA	1 cut(s)	232
Sau3AI	GATC	2 cut(s)	117, 195
ScrFI	CCNGG	1 cut(s)	226
SetI	ASST	5 cut(s)	141, 213, 227, 274, 279
SfaNI	GCATC	1 cut(s)	36
SmlI	CTYRAG	1 cut(s)	171
SmoI	CTYRAG	1 cut(s)	171
Sse9I	AATT	3 cut(s)	145, 189, 229
SseBI	AGGCCT	1 cut(s)	169
SsiI	CCGC	2 cut(s)	16, 49
SspMI	CTAG	1 cut(s)	59
StuI	AGGCCT	1 cut(s)	169
StyD4I	CCNGG	1 cut(s)	224
TaaI	ACNGT	2 cut(s)	81, 217
TasI	AATT	3 cut(s)	145, 189, 229
Tru1I	TTAA	1 cut(s)	232
Tru9I	TTAA	1 cut(s)	232
TscAI	CASTG	1 cut(s)	222
TseFI	GTSAC	1 cut(s)	211
Tsp45I	GTSAC	1 cut(s)	211
TspDTI	ATGAA	2 cut(s)	250, 259
TspRI	CASTG	1 cut(s)	222
VspI	ATTAAT	1 cut(s)	232
XapI	RAATTY	1 cut(s)	189
XspI	CTAG	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.