Rmu_sc0021997.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021997.1
Physical Location & Seq
Forward (+)
12087 .. 14035
1949 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021997.1_g000002.1.cds

Sequence Viewer

Length: 591 bp
atggagggagccgggtccagactgagccgagcgtcctccaggtacggcccaacaaccaccgtcttcagcggcccggtcaggaggtggaagaagaagtgggtccacgtgccgccatcaccgtcctccttcagctctcgctcccaatccaacgcccgaaacaacgacaacagctctcgcctcctcctttgccgctggaccccaatttcttctgcacctaactccgcagccgccgagcccggctccggcgacgagcggccccgccggaagttccgctacacgcctgttgttttgctagaggagcagaggaaggcggttgagaaaaggattgaggacatggaggatgcggagaacgctagtgagggagaccaatctactgtgctgagtgataagatgtatgggaagtcaaacgctgatcaagtcaaggagcaagaagctgaggaattggataataatggttcgcaggcctcaagtataaacaatctgaatttagatctgggcttgcaaggtcacagtgtcaacctggaattaatgaacaaaatgaaagaggctcagacgaaaactgcaagctcaggtgggttttggttgcagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

196

Amino Acids

21.66

Weight (kDa)

8.68

Isoelectric Point (pI)

70.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 253
AcsI RAATTY 1 cut(s) 484
AcuI CTGAAG 2 cut(s) 49, 112
AcvI CACGTG 1 cut(s) 106
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 242
AjnI CCWGG 2 cut(s) 38, 519
AluBI AGCT 4 cut(s) 132, 171, 434, 567
AluI AGCT 4 cut(s) 132, 171, 434, 567
Alw26I GTCTC 1 cut(s) 357
AoxI GGCC 4 cut(s) 46, 70, 254, 462
ApeKI GCWGC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 484
AseI ATTAAT 1 cut(s) 527
AspS9I GGNCC 6 cut(s) 15, 47, 71, 100, 195, 255
AsuC2I CCSGG 3 cut(s) 13, 74, 237
AsuHPI GGTGA 1 cut(s) 108
AvaII GGWCC 3 cut(s) 15, 100, 195
BanII GRGCYC 1 cut(s) 237
BarI GAAGNNNNNNTAC 2 cut(s) 257, 289
BbrPI CACGTG 1 cut(s) 106
BbsI GAAGAC 1 cut(s) 55
BbvCI CCTCAGC 1 cut(s) 435
BbvI GCAGC 1 cut(s) 236
BccI CCATC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 61
BciT130I CCWGG 2 cut(s) 40, 521
BclI TGATCA 1 cut(s) 412
BcnI CCSGG 3 cut(s) 13, 74, 237
BcoDI GTCTC 1 cut(s) 357
BfaI CTAG 2 cut(s) 293, 354
BglII AGATCT 1 cut(s) 490
BisI GCNGC 6 cut(s) 70, 110, 190, 225, 228, 254
BlsI GCNGC 6 cut(s) 71, 111, 191, 226, 229, 255
Bme1390I CCNGG 5 cut(s) 13, 40, 74, 237, 521
Bme18I GGWCC 3 cut(s) 15, 100, 195
BmgT120I GGNCC 6 cut(s) 15, 47, 71, 100, 195, 255
BmiI GGNNCC 6 cut(s) 10, 16, 101, 197, 241, 257
BmrFI CCNGG 5 cut(s) 13, 40, 74, 237, 521
BmsI GCATC 1 cut(s) 331
BpiI GAAGAC 1 cut(s) 55
BplI GAGNNNNNCTC 2 cut(s) 224, 256
BpmI CTGGAG 1 cut(s) 22
Bpu10I CCTNAGC 2 cut(s) 435, 568
BpuEI CTTGAG 1 cut(s) 451
BpuMI CCSGG 3 cut(s) 13, 74, 237
BsaAI YACGTR 1 cut(s) 106
BsaI GGTCTC 1 cut(s) 357
Bsc4I CCNNNNNNNGG 1 cut(s) 242
BseBI CCWGG 2 cut(s) 40, 521
BseGI GGATG 1 cut(s) 346
BseLI CCNNNNNNNGG 1 cut(s) 242
BseMII CTCAG 5 cut(s) 14, 371, 426, 563, 582
BseRI GAGGAG 2 cut(s) 170, 311
BseXI GCAGC 1 cut(s) 236
BsgI GTGCAG 1 cut(s) 195
BshFI GGCC 4 cut(s) 48, 72, 256, 464
BsiSI CCGG 5 cut(s) 12, 74, 237, 243, 262
BslI CCNNNNNNNGG 1 cut(s) 242
BsmAI GTCTC 1 cut(s) 357
BsnI GGCC 4 cut(s) 48, 72, 256, 464
Bso31I GGTCTC 1 cut(s) 357
Bsp1286I GDGCHC 1 cut(s) 237
Bsp143I GATC 2 cut(s) 412, 490
BspANI GGCC 4 cut(s) 48, 72, 256, 464
BspCNI CTCAG 5 cut(s) 15, 372, 427, 562, 581
BspLI GGNNCC 6 cut(s) 10, 16, 101, 197, 241, 257
BspTNI GGTCTC 1 cut(s) 357
BsrBI CCGCTC 1 cut(s) 253
BssMI GATC 2 cut(s) 412, 490
Bst2UI CCWGG 2 cut(s) 40, 521
Bst4CI ACNGT 4 cut(s) 61, 120, 376, 512
BstBAI YACGTR 1 cut(s) 106
BstC8I GCNNGC 3 cut(s) 462, 500, 565
BstDEI CTNAG 5 cut(s) 23, 380, 435, 549, 568
BstF5I GGATG 1 cut(s) 346
BstKTI GATC 2 cut(s) 415, 493
BstMAI GTCTC 1 cut(s) 357
BstMBI GATC 2 cut(s) 412, 490
BstMWI GCNNNNNNNGC 2 cut(s) 298, 350
BstNI CCWGG 2 cut(s) 40, 521
BstSCI CCNGG 5 cut(s) 11, 38, 72, 235, 519
BstV1I GCAGC 1 cut(s) 236
BstV2I GAAGAC 1 cut(s) 55
BstX2I RGATCY 1 cut(s) 490
BstYI RGATCY 1 cut(s) 490
BsuRI GGCC 4 cut(s) 48, 72, 256, 464
BtsCI GGATG 1 cut(s) 346
BtsIMutI CAGTG 1 cut(s) 517
Cac8I GCNNGC 3 cut(s) 462, 500, 565
Cfr13I GGNCC 6 cut(s) 15, 47, 71, 100, 195, 255
CseI GACGC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 334
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 5 cut(s) 23, 380, 435, 549, 568
DpnI GATC 2 cut(s) 414, 492
DpnII GATC 2 cut(s) 412, 490
Eco147I AGGCCT 1 cut(s) 464
Eco24I GRGCYC 1 cut(s) 237
Eco31I GGTCTC 1 cut(s) 357
Eco47I GGWCC 3 cut(s) 15, 100, 195
Eco57I CTGAAG 2 cut(s) 49, 112
Eco72I CACGTG 1 cut(s) 106
EcoRII CCWGG 2 cut(s) 38, 519
EcoT38I GRGCYC 1 cut(s) 237
FaeI CATG 1 cut(s) 337
FaiI YATR 3 cut(s) 335, 396, 473
FatI CATG 1 cut(s) 333
FauI CCCGC 1 cut(s) 266
FbaI TGATCA 1 cut(s) 412
Fnu4HI GCNGC 6 cut(s) 70, 110, 190, 225, 228, 254
FokI GGATG 1 cut(s) 353
FriOI GRGCYC 1 cut(s) 237
Fsp4HI GCNGC 6 cut(s) 70, 110, 190, 225, 228, 254
FspBI CTAG 2 cut(s) 293, 354
GluI GCNGC 6 cut(s) 70, 110, 190, 225, 228, 254
GsuI CTGGAG 1 cut(s) 22
HaeIII GGCC 4 cut(s) 48, 72, 256, 464
HapII CCGG 5 cut(s) 12, 74, 237, 243, 262
HgaI GACGC 1 cut(s) 21
Hin1II CATG 1 cut(s) 337
HincII GTYRAC 1 cut(s) 517
HindII GTYRAC 1 cut(s) 517
HpaII CCGG 5 cut(s) 12, 74, 237, 243, 262
HphI GGTGA 1 cut(s) 108
Hpy166II GTNNAC 2 cut(s) 103, 517
Hpy188I TCNGA 2 cut(s) 483, 552
Hpy188III TCNNGA 2 cut(s) 18, 79
Hpy8I GTNNAC 2 cut(s) 103, 517
Hpy99I CGWCG 1 cut(s) 251
HpyAV CCTTC 2 cut(s) 136, 301
HpyCH4III ACNGT 4 cut(s) 61, 120, 376, 512
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 4 cut(s) 212, 502, 563, 586
HpyF10VI GCNNNNNNNGC 2 cut(s) 298, 350
HpyF3I CTNAG 5 cut(s) 23, 380, 435, 549, 568
HpySE526I ACGT 1 cut(s) 105
Hsp92II CATG 1 cut(s) 337
Ksp22I TGATCA 1 cut(s) 412
Kzo9I GATC 2 cut(s) 412, 490
LmnI GCTCC 5 cut(s) 8, 143, 245, 298, 424
Lsp1109I GCAGC 1 cut(s) 236
LweI GCATC 1 cut(s) 331
MaeI CTAG 2 cut(s) 293, 354
MaeII ACGT 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 506
MalI GATC 2 cut(s) 414, 492
MbiI CCGCTC 1 cut(s) 253
MboI GATC 2 cut(s) 412, 490
MboII GAAGA 4 cut(s) 55, 100, 103, 198
MflI RGATCY 1 cut(s) 490
MhlI GDGCHC 1 cut(s) 237
MluCI AATT 4 cut(s) 201, 440, 484, 524
MmeI TCCRAC 1 cut(s) 171
MseI TTAA 1 cut(s) 527
MspA1I CMGCKG 2 cut(s) 69, 192
MspI CCGG 5 cut(s) 12, 74, 237, 243, 262
MspR9I CCNGG 5 cut(s) 13, 40, 74, 237, 521
MvaI CCWGG 2 cut(s) 40, 521
MwoI GCNNNNNNNGC 2 cut(s) 298, 350
NciI CCSGG 3 cut(s) 13, 74, 237
NdeII GATC 2 cut(s) 412, 490
NlaIII CATG 1 cut(s) 337
NlaIV GGNNCC 6 cut(s) 10, 16, 101, 197, 241, 257
NmeAIII GCCGAG 2 cut(s) 53, 256
NmuCI GTSAC 1 cut(s) 506
PceI AGGCCT 1 cut(s) 464
PkrI GCNGC 6 cut(s) 71, 111, 191, 226, 229, 255
PmaCI CACGTG 1 cut(s) 106
PmlI CACGTG 1 cut(s) 106
Ppu21I YACGTR 1 cut(s) 106
PshBI ATTAAT 1 cut(s) 527
Psp6I CCWGG 2 cut(s) 38, 519
PspCI CACGTG 1 cut(s) 106
PspGI CCWGG 2 cut(s) 38, 519
PspN4I GGNNCC 6 cut(s) 10, 16, 101, 197, 241, 257
PspPI GGNCC 6 cut(s) 15, 47, 71, 100, 195, 255
PsuI RGATCY 1 cut(s) 490
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 1 cut(s) 527
SatI GCNGC 6 cut(s) 70, 110, 190, 225, 228, 254
Sau3AI GATC 2 cut(s) 412, 490
Sau96I GGNCC 6 cut(s) 15, 47, 71, 100, 195, 255
ScrFI CCNGG 5 cut(s) 13, 40, 74, 237, 521
SduI GDGCHC 1 cut(s) 237
SfaNI GCATC 1 cut(s) 331
SinI GGWCC 3 cut(s) 15, 100, 195
SmlI CTYRAG 1 cut(s) 466
SmoI CTYRAG 1 cut(s) 466
Sse9I AATT 4 cut(s) 201, 440, 484, 524
SseBI AGGCCT 1 cut(s) 464
SspMI CTAG 2 cut(s) 293, 354
StuI AGGCCT 1 cut(s) 464
StyD4I CCNGG 5 cut(s) 11, 38, 72, 235, 519
TaaI ACNGT 4 cut(s) 61, 120, 376, 512
TaiI ACGT 1 cut(s) 108
TasI AATT 4 cut(s) 201, 440, 484, 524
TauI GCSGC 5 cut(s) 72, 112, 192, 230, 256
Tru1I TTAA 1 cut(s) 527
Tru9I TTAA 1 cut(s) 527
TscAI CASTG 1 cut(s) 517
TseFI GTSAC 1 cut(s) 506
TseI GCWGC 1 cut(s) 224
Tsp45I GTSAC 1 cut(s) 506
TspDTI ATGAA 2 cut(s) 545, 554
TspRI CASTG 1 cut(s) 517
VpaK11BI GGWCC 3 cut(s) 15, 100, 195
VspI ATTAAT 1 cut(s) 527
XapI RAATTY 1 cut(s) 484
XspI CTAG 2 cut(s) 293, 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.