Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014067.1

Orthogroup ID

OG0010819

Physical Location & Seq

Genomic Coordinates Forward (+)

23717 .. 24103

Gene Structure 387 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014067.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

atggagggagccgggtccagactgagccgagcgtcctccaggtacggcccaacaaccaccgtcttcagcggcccggtcaggaggtggaagaagaagtgggtccacgtgccgccatcaccgtcctccttcagctctcgctcccaatccaacgcccgaaacaacgacaacagctctcgcctcctcctttgccgctggaccccaatttcttctgcacctaactccgcagccgccgagcccggctccggcgacgagcggccccgccggaagttccgctacacgcctgtaagtgaagtagcatgggtatctgtgtgtttgtattcactgtatatgaaggttagagtagttagggtttatggaaatttagggttttgttgcagaagtgattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

128

Amino Acids

14.31

Weight (kDa)

10.7

Isoelectric Point (pI)

70.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010819)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55210
fragaria_vesca	FvH4_3g23530 FvH4_3g23530 FvH4_3g23530
malus_domestica	MD03G1193400.v1.1 MD11G1209600.v1.1
prunus_persica	Prupe.4G223100_v2.0.a1
pyrus_communis	pycom11g18510
rosa_chinensis	RchiOBHm_Chr5g0041531
rosa_laevigata	RLG00000034076
rosa_multiflora	Rmu_co8457507.1_g000001 Rmu_sc0014067.1_g000008 Rmu_sc0021997.1_g000002 Rmu_sc0029151.1_g000002
rosa_roxburghii	Rroxscaffold_1G00039000
rosa_rugosa	Rorug05G0193400
rosa_samantha	Rh5AG278900 Rh5BG283300 Rh5CG316200
rosa_wichuraiana	Rw5G026270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	253
AciI	CCGC	8 cut(s)	69, 110, 190, 222, 228, 253, 259, 271
AcsI	RAATTY	1 cut(s)	358
AcuI	CTGAAG	2 cut(s)	49, 112
AcvI	CACGTG	1 cut(s)	106
AfaI	GTAC	1 cut(s)	44
AfiI	CCNNNNNNNGG	1 cut(s)	242
AjnI	CCWGG	1 cut(s)	38
AluBI	AGCT	2 cut(s)	132, 171
AluI	AGCT	2 cut(s)	132, 171
AoxI	GGCC	3 cut(s)	46, 70, 254
ApeKI	GCWGC	1 cut(s)	224
ApoI	RAATTY	1 cut(s)	358
AspS9I	GGNCC	6 cut(s)	15, 47, 71, 100, 195, 255
AsuC2I	CCSGG	3 cut(s)	13, 74, 237
AsuHPI	GGTGA	1 cut(s)	108
AvaII	GGWCC	3 cut(s)	15, 100, 195
BanII	GRGCYC	1 cut(s)	237
BarI	GAAGNNNNNNTAC	2 cut(s)	257, 289
BbrPI	CACGTG	1 cut(s)	106
BbsI	GAAGAC	1 cut(s)	55
BbvI	GCAGC	1 cut(s)	236
BccI	CCATC	1 cut(s)	121
BceAI	ACGGC	1 cut(s)	61
BciT130I	CCWGG	1 cut(s)	40
BcnI	CCSGG	3 cut(s)	13, 74, 237
BisI	GCNGC	6 cut(s)	70, 110, 190, 225, 228, 254
BlsI	GCNGC	6 cut(s)	71, 111, 191, 226, 229, 255
Bme1390I	CCNGG	4 cut(s)	13, 40, 74, 237
Bme18I	GGWCC	3 cut(s)	15, 100, 195
BmgT120I	GGNCC	6 cut(s)	15, 47, 71, 100, 195, 255
BmiI	GGNNCC	6 cut(s)	10, 16, 101, 197, 241, 257
BmrFI	CCNGG	4 cut(s)	13, 40, 74, 237
BpiI	GAAGAC	1 cut(s)	55
BplI	GAGNNNNNCTC	2 cut(s)	224, 256
BpmI	CTGGAG	1 cut(s)	22
BpuMI	CCSGG	3 cut(s)	13, 74, 237
BsaAI	YACGTR	1 cut(s)	106
Bsc4I	CCNNNNNNNGG	1 cut(s)	242
BseBI	CCWGG	1 cut(s)	40
BseLI	CCNNNNNNNGG	1 cut(s)	242
BseMII	CTCAG	1 cut(s)	14
BseRI	GAGGAG	1 cut(s)	170
BseXI	GCAGC	1 cut(s)	236
BsgI	GTGCAG	1 cut(s)	195
BshFI	GGCC	3 cut(s)	48, 72, 256
BsiSI	CCGG	5 cut(s)	12, 74, 237, 243, 262
BslI	CCNNNNNNNGG	1 cut(s)	242
BsnI	GGCC	3 cut(s)	48, 72, 256
Bsp1286I	GDGCHC	1 cut(s)	237
BspACI	CCGC	8 cut(s)	69, 110, 190, 222, 228, 253, 259, 271
BspANI	GGCC	3 cut(s)	48, 72, 256
BspCNI	CTCAG	1 cut(s)	15
BspLI	GGNNCC	6 cut(s)	10, 16, 101, 197, 241, 257
BsrBI	CCGCTC	1 cut(s)	253
Bst2UI	CCWGG	1 cut(s)	40
Bst4CI	ACNGT	3 cut(s)	61, 120, 324
BstBAI	YACGTR	1 cut(s)	106
BstDEI	CTNAG	1 cut(s)	23
BstNI	CCWGG	1 cut(s)	40
BstSCI	CCNGG	4 cut(s)	11, 38, 72, 235
BstV1I	GCAGC	1 cut(s)	236
BstV2I	GAAGAC	1 cut(s)	55
BsuRI	GGCC	3 cut(s)	48, 72, 256
BtsIMutI	CAGTG	1 cut(s)	320
Cfr13I	GGNCC	6 cut(s)	15, 47, 71, 100, 195, 255
CseI	GACGC	1 cut(s)	21
Csp6I	GTAC	1 cut(s)	43
CviAII	CATG	1 cut(s)	297
CviQI	GTAC	1 cut(s)	43
DdeI	CTNAG	1 cut(s)	23
Eco24I	GRGCYC	1 cut(s)	237
Eco47I	GGWCC	3 cut(s)	15, 100, 195
Eco57I	CTGAAG	2 cut(s)	49, 112
Eco72I	CACGTG	1 cut(s)	106
EcoRII	CCWGG	1 cut(s)	38
EcoT38I	GRGCYC	1 cut(s)	237
FaeI	CATG	1 cut(s)	300
FaiI	YATR	4 cut(s)	298, 327, 329, 354
FatI	CATG	1 cut(s)	296
FauI	CCCGC	1 cut(s)	266
Fnu4HI	GCNGC	6 cut(s)	70, 110, 190, 225, 228, 254
FriOI	GRGCYC	1 cut(s)	237
Fsp4HI	GCNGC	6 cut(s)	70, 110, 190, 225, 228, 254
GluI	GCNGC	6 cut(s)	70, 110, 190, 225, 228, 254
GsuI	CTGGAG	1 cut(s)	22
HaeIII	GGCC	3 cut(s)	48, 72, 256
HapII	CCGG	5 cut(s)	12, 74, 237, 243, 262
HgaI	GACGC	1 cut(s)	21
Hin1II	CATG	1 cut(s)	300
HpaII	CCGG	5 cut(s)	12, 74, 237, 243, 262
HphI	GGTGA	1 cut(s)	108
Hpy166II	GTNNAC	1 cut(s)	103
Hpy188III	TCNNGA	2 cut(s)	18, 79
Hpy8I	GTNNAC	1 cut(s)	103
Hpy99I	CGWCG	1 cut(s)	251
HpyAV	CCTTC	2 cut(s)	136, 325
HpyCH4III	ACNGT	3 cut(s)	61, 120, 324
HpyCH4IV	ACGT	1 cut(s)	105
HpyCH4V	TGCA	2 cut(s)	212, 375
HpyF3I	CTNAG	1 cut(s)	23
HpySE526I	ACGT	1 cut(s)	105
Hsp92II	CATG	1 cut(s)	300
LmnI	GCTCC	3 cut(s)	8, 143, 245
Lsp1109I	GCAGC	1 cut(s)	236
MaeII	ACGT	1 cut(s)	105
MbiI	CCGCTC	1 cut(s)	253
MboII	GAAGA	4 cut(s)	55, 100, 103, 198
MhlI	GDGCHC	1 cut(s)	237
MluCI	AATT	2 cut(s)	201, 358
MmeI	TCCRAC	1 cut(s)	171
MnlI	CCTC	5 cut(s)	46, 75, 133, 188, 191
MspA1I	CMGCKG	2 cut(s)	69, 192
MspI	CCGG	5 cut(s)	12, 74, 237, 243, 262
MspR9I	CCNGG	4 cut(s)	13, 40, 74, 237
MvaI	CCWGG	1 cut(s)	40
NciI	CCSGG	3 cut(s)	13, 74, 237
NlaIII	CATG	1 cut(s)	300
NlaIV	GGNNCC	6 cut(s)	10, 16, 101, 197, 241, 257
NmeAIII	GCCGAG	2 cut(s)	53, 256
PkrI	GCNGC	6 cut(s)	71, 111, 191, 226, 229, 255
PmaCI	CACGTG	1 cut(s)	106
PmlI	CACGTG	1 cut(s)	106
Ppu21I	YACGTR	1 cut(s)	106
Psp6I	CCWGG	1 cut(s)	38
PspCI	CACGTG	1 cut(s)	106
PspGI	CCWGG	1 cut(s)	38
PspN4I	GGNNCC	6 cut(s)	10, 16, 101, 197, 241, 257
PspPI	GGNCC	6 cut(s)	15, 47, 71, 100, 195, 255
RsaI	GTAC	1 cut(s)	44
RsaNI	GTAC	1 cut(s)	43
SatI	GCNGC	6 cut(s)	70, 110, 190, 225, 228, 254
Sau96I	GGNCC	6 cut(s)	15, 47, 71, 100, 195, 255
ScrFI	CCNGG	4 cut(s)	13, 40, 74, 237
SduI	GDGCHC	1 cut(s)	237
SetI	ASST	7 cut(s)	44, 86, 108, 134, 173, 217, 336
SinI	GGWCC	3 cut(s)	15, 100, 195
Sse9I	AATT	2 cut(s)	201, 358
SsiI	CCGC	8 cut(s)	69, 110, 190, 222, 228, 253, 259, 271
StyD4I	CCNGG	4 cut(s)	11, 38, 72, 235
TaaI	ACNGT	3 cut(s)	61, 120, 324
TaiI	ACGT	1 cut(s)	108
TasI	AATT	2 cut(s)	201, 358
TauI	GCSGC	5 cut(s)	72, 112, 192, 230, 256
TscAI	CASTG	1 cut(s)	327
TseI	GCWGC	1 cut(s)	224
TspDTI	ATGAA	1 cut(s)	344
TspRI	CASTG	1 cut(s)	327
VpaK11BI	GGWCC	3 cut(s)	15, 100, 195
XapI	RAATTY	1 cut(s)	358

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.