Rmu_co8473347.1_g000001

The H protein shuttles the methylamine group of glycine from the P protein to the T protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8473347.1
Physical Location & Seq
Forward (+)
686 .. 1948
1263 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8473347.1_g000001.1.cds

Sequence Viewer

Length: 486 bp
atgtgggcttcttctacagcaaatgcactcagaatctctggtgcctccaaagctcaactctcccctgcattctctctctccagatgcttttccactgttctggatgggttgaagtatgcatcttcacatgaatgggtgaagcatgaaggctcagttgctacaattggtatcactgaccatgctcaggaccatcttggtgaagtggtgtttgtggagctgccagaacccggtacagcagtctcccaaagcagcagcttcggaaatgttgaaagtgtgaaagcaaccagtgatgtgaattccccaatctctggtgaggttgttgaggttaacccgaagctgagtgaaacacctggtttgatcaatacaagcccatatgaagatggatggatgatcaaggtgaagcccagcaatgcatcagaactagaatccttgttgggtcctaaagaatacacgaaattctgcgaggaagaagatgcagcccactag

Protein Analysis

161

Amino Acids

17.17

Weight (kDa)

4.76

Isoelectric Point (pI)

40.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012278)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 41
AccB7I CCANNNNNTGG 1 cut(s) 308
AcsI RAATTY 2 cut(s) 295, 455
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 3 cut(s) 184, 227, 308
AgsI TTSAA 2 cut(s) 112, 269
AjnI CCWGG 1 cut(s) 349
AluBI AGCT 4 cut(s) 53, 217, 255, 337
AluI AGCT 4 cut(s) 53, 217, 255, 337
Alw26I GTCTC 1 cut(s) 244
ApeKI GCWGC 4 cut(s) 217, 249, 252, 476
ApoI RAATTY 2 cut(s) 295, 455
AspS9I GGNCC 2 cut(s) 187, 437
AsuC2I CCSGG 1 cut(s) 228
AsuHPI GGTGA 4 cut(s) 148, 209, 323, 409
AvaII GGWCC 2 cut(s) 187, 437
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BanI GGYRCC 1 cut(s) 41
BbvI GCAGC 3 cut(s) 204, 261, 264
BccI CCATC 4 cut(s) 98, 198, 374, 378
BcgI CGANNNNNNTGC 2 cut(s) 238, 272
BciT130I CCWGG 1 cut(s) 351
BclI TGATCA 2 cut(s) 357, 390
BcnI CCSGG 1 cut(s) 228
BcoDI GTCTC 1 cut(s) 244
BfaI CTAG 2 cut(s) 422, 484
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 4 cut(s) 218, 250, 253, 477
BlsI GCNGC 4 cut(s) 219, 251, 254, 478
Bme1390I CCNGG 2 cut(s) 228, 351
Bme18I GGWCC 2 cut(s) 187, 437
BmgT120I GGNCC 2 cut(s) 187, 437
BmiI GGNNCC 2 cut(s) 43, 438
BmrFI CCNGG 2 cut(s) 228, 351
BmsI GCATC 4 cut(s) 74, 128, 422, 463
BpmI CTGGAG 1 cut(s) 64
Bpu10I CCTNAGC 1 cut(s) 183
BpuMI CCSGG 1 cut(s) 228
Bsc4I CCNNNNNNNGG 3 cut(s) 184, 227, 308
Bse1I ACTGG 1 cut(s) 285
Bse3DI GCAATG 1 cut(s) 415
BseBI CCWGG 1 cut(s) 351
BseGI GGATG 3 cut(s) 109, 389, 393
BseLI CCNNNNNNNGG 3 cut(s) 184, 227, 308
BseMI GCAATG 1 cut(s) 415
BseMII CTCAG 4 cut(s) 43, 165, 197, 329
BseNI ACTGG 1 cut(s) 285
BseXI GCAGC 3 cut(s) 204, 261, 264
BseYI CCCAGC 1 cut(s) 404
BshNI GGYRCC 1 cut(s) 41
BsiSI CCGG 1 cut(s) 228
BslI CCNNNNNNNGG 3 cut(s) 184, 227, 308
BsmAI GTCTC 1 cut(s) 244
BsmI GAATGC 1 cut(s) 68
Bsp143I GATC 2 cut(s) 357, 390
BspCNI CTCAG 4 cut(s) 42, 164, 196, 330
BspLI GGNNCC 2 cut(s) 43, 438
BspT107I GGYRCC 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 415
BsrI ACTGG 1 cut(s) 285
BssMI GATC 2 cut(s) 357, 390
Bst2UI CCWGG 1 cut(s) 351
Bst4CI ACNGT 1 cut(s) 97
BstDEI CTNAG 4 cut(s) 29, 151, 183, 338
BstF5I GGATG 3 cut(s) 109, 389, 393
BstKTI GATC 2 cut(s) 360, 393
BstMAI GTCTC 1 cut(s) 244
BstMBI GATC 2 cut(s) 357, 390
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 351
BstSCI CCNGG 2 cut(s) 226, 349
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 3 cut(s) 204, 261, 264
BstXI CCANNNNNNTGG 1 cut(s) 100
BtsCI GGATG 3 cut(s) 109, 389, 393
BtsIMutI CAGTG 3 cut(s) 93, 171, 292
Cfr13I GGNCC 2 cut(s) 187, 437
CsiI ACCWGGT 1 cut(s) 349
Csp6I GTAC 1 cut(s) 231
CviAII CATG 3 cut(s) 128, 143, 179
CviJI RGCY 9 cut(s) 8, 53, 150, 217, 255, 337, 369, 403, 479
CviKI_1 RGCY 9 cut(s) 8, 53, 150, 217, 255, 337, 369, 403, 479
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 4 cut(s) 29, 151, 183, 338
DpnI GATC 2 cut(s) 359, 392
DpnII GATC 2 cut(s) 357, 390
Eco47I GGWCC 2 cut(s) 187, 437
EcoO109I RGGNCCY 1 cut(s) 437
EcoRI GAATTC 1 cut(s) 295
EcoRII CCWGG 1 cut(s) 349
EcoT22I ATGCAT 2 cut(s) 121, 415
FaeI CATG 3 cut(s) 131, 146, 182
FaiI YATR 6 cut(s) 117, 129, 144, 180, 373, 375
FatI CATG 3 cut(s) 127, 142, 178
FauNDI CATATG 1 cut(s) 373
FbaI TGATCA 2 cut(s) 357, 390
Fnu4HI GCNGC 4 cut(s) 218, 250, 253, 477
FokI GGATG 3 cut(s) 116, 396, 400
Fsp4HI GCNGC 4 cut(s) 218, 250, 253, 477
FspBI CTAG 2 cut(s) 422, 484
GluI GCNGC 4 cut(s) 218, 250, 253, 477
GsaI CCCAGC 1 cut(s) 408
GsuI CTGGAG 1 cut(s) 64
HapII CCGG 1 cut(s) 228
Hin1II CATG 3 cut(s) 131, 146, 182
HincII GTYRAC 1 cut(s) 328
HindII GTYRAC 1 cut(s) 328
HinfI GANTC 2 cut(s) 33, 425
HpaI GTTAAC 1 cut(s) 328
HpaII CCGG 1 cut(s) 228
HphI GGTGA 4 cut(s) 148, 209, 323, 409
Hpy166II GTNNAC 1 cut(s) 328
Hpy188I TCNGA 3 cut(s) 32, 260, 418
Hpy188III TCNNGA 3 cut(s) 81, 101, 185
Hpy8I GTNNAC 1 cut(s) 328
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 5 cut(s) 26, 68, 119, 413, 476
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 4 cut(s) 29, 151, 183, 338
Hsp92II CATG 3 cut(s) 131, 146, 182
Ksp22I TGATCA 2 cut(s) 357, 390
KspAI GTTAAC 1 cut(s) 328
Kzo9I GATC 2 cut(s) 357, 390
LmnI GCTCC 1 cut(s) 214
Lsp1109I GCAGC 3 cut(s) 204, 261, 264
LweI GCATC 4 cut(s) 74, 128, 422, 463
MabI ACCWGGT 1 cut(s) 349
MaeI CTAG 2 cut(s) 422, 484
MalI GATC 2 cut(s) 359, 392
MboI GATC 2 cut(s) 357, 390
MboII GAAGA 5 cut(s) 3, 114, 389, 479, 482
MfeI CAATTG 1 cut(s) 162
MluCI AATT 3 cut(s) 162, 295, 455
MnlI CCTC 4 cut(s) 55, 307, 316, 457
Mph1103I ATGCAT 2 cut(s) 121, 415
MseI TTAA 1 cut(s) 327
MslI CAYNNNNRTG 2 cut(s) 130, 195
MspI CCGG 1 cut(s) 228
MspR9I CCNGG 2 cut(s) 228, 351
MunI CAATTG 1 cut(s) 162
Mva1269I GAATGC 1 cut(s) 68
MvaI CCWGG 1 cut(s) 351
MwoI GCNNNNNNNGC 1 cut(s) 50
NciI CCSGG 1 cut(s) 228
NdeI CATATG 1 cut(s) 373
NdeII GATC 2 cut(s) 357, 390
NlaIII CATG 3 cut(s) 131, 146, 182
NlaIV GGNNCC 2 cut(s) 43, 438
NsiI ATGCAT 2 cut(s) 121, 415
PctI GAATGC 1 cut(s) 68
PfeI GAWTC 2 cut(s) 33, 425
PflMI CCANNNNNTGG 1 cut(s) 308
PkrI GCNGC 4 cut(s) 219, 251, 254, 478
PpuMI RGGWCCY 1 cut(s) 437
Psp5II RGGWCCY 1 cut(s) 437
Psp6I CCWGG 1 cut(s) 349
PspFI CCCAGC 1 cut(s) 404
PspGI CCWGG 1 cut(s) 349
PspN4I GGNNCC 2 cut(s) 43, 438
PspPI GGNCC 2 cut(s) 187, 437
PspPPI RGGWCCY 1 cut(s) 437
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
RseI CAYNNNNRTG 2 cut(s) 130, 195
SaqAI TTAA 1 cut(s) 327
SatI GCNGC 4 cut(s) 218, 250, 253, 477
Sau3AI GATC 2 cut(s) 357, 390
Sau96I GGNCC 2 cut(s) 187, 437
ScrFI CCNGG 2 cut(s) 228, 351
SetI ASST 8 cut(s) 55, 219, 257, 318, 327, 339, 352, 399
SexAI ACCWGGT 1 cut(s) 349
SfaNI GCATC 4 cut(s) 74, 128, 422, 463
SfcI CTRYAG 1 cut(s) 15
SinI GGWCC 2 cut(s) 187, 437
SmiMI CAYNNNNRTG 2 cut(s) 130, 195
Sse9I AATT 3 cut(s) 162, 295, 455
SspMI CTAG 2 cut(s) 422, 484
StyD4I CCNGG 2 cut(s) 226, 349
TaaI ACNGT 1 cut(s) 97
TasI AATT 3 cut(s) 162, 295, 455
TfiI GAWTC 2 cut(s) 33, 425
Tru1I TTAA 1 cut(s) 327
Tru9I TTAA 1 cut(s) 327
TscAI CASTG 3 cut(s) 100, 178, 292
TseI GCWGC 4 cut(s) 217, 249, 252, 476
TspDTI ATGAA 3 cut(s) 144, 159, 390
TspRI CASTG 3 cut(s) 100, 178, 292
Van91I CCANNNNNTGG 1 cut(s) 308
VpaK11BI GGWCC 2 cut(s) 187, 437
XapI RAATTY 2 cut(s) 295, 455
XspI CTAG 2 cut(s) 422, 484
Zsp2I ATGCAT 2 cut(s) 121, 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.