Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8499097.1

Orthogroup ID

OG0013039

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 787

Gene Structure 787 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8499097.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

gcccctcctcgtgctgatgttatcaaaagcttaaggaatggcattggactgaaccttttgggtatgggtgctgctgttcttggtatgcaagccacagtaggaatattggttgctaaggctcttacgtcctcagcaactccatattaccagggtatctctcctggctacagtcctgttcttgcattggatgtattcttggtgcaggcatctgcaaacactatcctttcacatttcttggggcttgttttctcattagagctgttgcgctcagtgtcattgccacctgcagaaggcagccccattcctaggatggcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006605 GO:0006810 GO:0006873 GO:0006875 GO:0006886 GO:0008104 GO:0008150 GO:0009507 GO:0009526 GO:0009528 GO:0009536 GO:0009706 GO:0009941 GO:0009987 GO:0015031 GO:0015833 GO:0016020 GO:0017038 GO:0019725 GO:0019866 GO:0030003 GO:0031090 GO:0031967 GO:0031969 GO:0031975 GO:0033036 GO:0033365 GO:0034613 GO:0042170 GO:0042592 GO:0042802 GO:0042803 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0045036 GO:0045037 GO:0045184 GO:0046907 GO:0046983 GO:0048878 GO:0050801 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0055065 GO:0055080 GO:0055082 GO:0055085 GO:0065002 GO:0065007 GO:0065008 GO:0070727 GO:0071702 GO:0071705 GO:0071806 GO:0072594 GO:0072596 GO:0072598 GO:0098771

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3611

Protein Analysis

105

Amino Acids

10.8

Weight (kDa)

9.4

Isoelectric Point (pI)

38.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013039)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15290
fragaria_vesca	FvH4_2g05240
malus_domestica	MD05G1088600.v1.1 MD10G1096700.v1.1
prunus_persica	Prupe.8G134600_v2.0.a1 Prupe.8G134600_v2.0.a1
pyrus_communis	pycom05g08800 pycom10g08280
rosa_chinensis	RchiOBHm_Chr6g0255371
rosa_laevigata	RLG00000014843
rosa_multiflora	Rmu_co8499097.1_g000001 Rmu_sc0002360.1_g000018
rosa_roxburghii	Rroxscaffold_7G00210040
rosa_rugosa	Rorug05G0557700
rosa_samantha	Rh6AG075500 Rh6BG068100 Rh6CG067800 Rh6DG064400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	292
Acc36I	ACCTGC	1 cut(s)	292
AfiI	CCNNNNNNNGG	2 cut(s)	290, 306
AflII	CTTAAG	1 cut(s)	31
AjnI	CCWGG	2 cut(s)	147, 160
AluBI	AGCT	2 cut(s)	30, 259
AluI	AGCT	2 cut(s)	30, 259
ApeKI	GCWGC	2 cut(s)	71, 294
AspA2I	CCTAGG	1 cut(s)	305
AspLEI	GCGC	1 cut(s)	267
AvrII	CCTAGG	1 cut(s)	305
BaeI	ACNNNNGTAYC	2 cut(s)	136, 169
BauI	CACGAG	1 cut(s)	9
BbvCI	CCTCAGC	1 cut(s)	130
BbvI	GCAGC	2 cut(s)	58, 306
BccI	CCATC	1 cut(s)	304
BciT130I	CCWGG	2 cut(s)	149, 162
BfaI	CTAG	1 cut(s)	306
BfmI	CTRYAG	2 cut(s)	166, 285
BfrI	CTTAAG	1 cut(s)	31
BfuAI	ACCTGC	1 cut(s)	292
BisI	GCNGC	2 cut(s)	72, 295
BlnI	CCTAGG	1 cut(s)	305
BlsI	GCNGC	2 cut(s)	73, 296
Bme1390I	CCNGG	2 cut(s)	149, 162
BmrFI	CCNGG	2 cut(s)	149, 162
BmsI	GCATC	1 cut(s)	215
Bpu10I	CCTNAGC	2 cut(s)	114, 130
BsaJI	CCNNGG	2 cut(s)	148, 305
Bsc4I	CCNNNNNNNGG	2 cut(s)	290, 306
Bse3DI	GCAATG	1 cut(s)	275
BseBI	CCWGG	2 cut(s)	149, 162
BseDI	CCNNGG	2 cut(s)	148, 305
BseGI	GGATG	2 cut(s)	193, 315
BseLI	CCNNNNNNNGG	2 cut(s)	290, 306
BseMI	GCAATG	1 cut(s)	275
BseMII	CTCAG	2 cut(s)	144, 282
BseXI	GCAGC	2 cut(s)	58, 306
BsgI	GTGCAG	1 cut(s)	221
BslI	CCNNNNNNNGG	2 cut(s)	290, 306
BspCNI	CTCAG	2 cut(s)	143, 281
BspMAI	CTGCAG	1 cut(s)	289
BspMI	ACCTGC	1 cut(s)	292
BspTI	CTTAAG	1 cut(s)	31
BsrDI	GCAATG	1 cut(s)	275
BssECI	CCNNGG	2 cut(s)	148, 305
BssSI	CACGAG	1 cut(s)	9
BssT1I	CCWWGG	1 cut(s)	305
Bst2BI	CACGAG	1 cut(s)	9
Bst2UI	CCWGG	2 cut(s)	149, 162
Bst4CI	ACNGT	2 cut(s)	97, 170
BstAFI	CTTAAG	1 cut(s)	31
BstC8I	GCNNGC	2 cut(s)	90, 204
BstDEI	CTNAG	3 cut(s)	114, 130, 268
BstENI	CCTNNNNNAGG	1 cut(s)	288
BstF5I	GGATG	2 cut(s)	193, 315
BstHHI	GCGC	1 cut(s)	267
BstNI	CCWGG	2 cut(s)	149, 162
BstSCI	CCNGG	2 cut(s)	147, 160
BstSFI	CTRYAG	2 cut(s)	166, 285
BstV1I	GCAGC	2 cut(s)	58, 306
BtsCI	GGATG	2 cut(s)	193, 315
BtsIMutI	CAGTG	1 cut(s)	276
BveI	ACCTGC	1 cut(s)	292
Cac8I	GCNNGC	2 cut(s)	90, 204
CfoI	GCGC	1 cut(s)	267
CviJI	RGCY	8 cut(s)	30, 92, 119, 165, 241, 259, 297, 314
CviKI_1	RGCY	8 cut(s)	30, 92, 119, 165, 241, 259, 297, 314
DdeI	CTNAG	3 cut(s)	114, 130, 268
Eco130I	CCWWGG	1 cut(s)	305
EcoNI	CCTNNNNNAGG	1 cut(s)	288
EcoRII	CCWGG	2 cut(s)	147, 160
EcoT14I	CCWWGG	1 cut(s)	305
ErhI	CCWWGG	1 cut(s)	305
FaiI	YATR	3 cut(s)	65, 86, 142
Fnu4HI	GCNGC	2 cut(s)	72, 295
FokI	GGATG	1 cut(s)	200
Fsp4HI	GCNGC	2 cut(s)	72, 295
FspBI	CTAG	1 cut(s)	306
GlaI	GCGC	1 cut(s)	266
GluI	GCNGC	2 cut(s)	72, 295
HhaI	GCGC	1 cut(s)	267
Hin6I	GCGC	1 cut(s)	265
HinP1I	GCGC	1 cut(s)	265
HindIII	AAGCTT	1 cut(s)	28
HpyAV	CCTTC	1 cut(s)	284
HpyCH4III	ACNGT	2 cut(s)	97, 170
HpyCH4IV	ACGT	1 cut(s)	125
HpyCH4V	TGCA	5 cut(s)	88, 182, 202, 212, 287
HpyF3I	CTNAG	3 cut(s)	114, 130, 268
HpySE526I	ACGT	1 cut(s)	125
HspAI	GCGC	1 cut(s)	265
LpnPI	CCDG	7 cut(s)	134, 147, 161, 174, 186, 188, 297
Lsp1109I	GCAGC	2 cut(s)	58, 306
LweI	GCATC	1 cut(s)	215
MaeI	CTAG	1 cut(s)	306
MaeII	ACGT	1 cut(s)	125
MnlI	CCTC	3 cut(s)	15, 18, 139
MseI	TTAA	2 cut(s)	32, 316
MspCI	CTTAAG	1 cut(s)	31
MspR9I	CCNGG	2 cut(s)	149, 162
MvaI	CCWGG	2 cut(s)	149, 162
PaqCI	CACCTGC	1 cut(s)	292
PkrI	GCNGC	2 cut(s)	73, 296
Psp6I	CCWGG	2 cut(s)	147, 160
PspGI	CCWGG	2 cut(s)	147, 160
PstI	CTGCAG	1 cut(s)	289
SaqAI	TTAA	2 cut(s)	32, 316
SatI	GCNGC	2 cut(s)	72, 295
ScrFI	CCNGG	2 cut(s)	149, 162
SetI	ASST	5 cut(s)	32, 57, 128, 261, 286
SfaNI	GCATC	1 cut(s)	215
SfcI	CTRYAG	2 cut(s)	166, 285
SmlI	CTYRAG	1 cut(s)	31
SmoI	CTYRAG	1 cut(s)	31
SspI	AATATT	1 cut(s)	105
SspMI	CTAG	1 cut(s)	306
StyD4I	CCNGG	2 cut(s)	147, 160
StyI	CCWWGG	1 cut(s)	305
TaaI	ACNGT	2 cut(s)	97, 170
TaiI	ACGT	1 cut(s)	128
Tru1I	TTAA	2 cut(s)	32, 316
Tru9I	TTAA	2 cut(s)	32, 316
TscAI	CASTG	1 cut(s)	276
TseI	GCWGC	2 cut(s)	71, 294
TspRI	CASTG	1 cut(s)	276
Vha464I	CTTAAG	1 cut(s)	31
XagI	CCTNNNNNAGG	1 cut(s)	288
XcmI	CCANNNNNNNNNTGG	1 cut(s)	307
XmaJI	CCTAGG	1 cut(s)	305
XspI	CTAG	1 cut(s)	306

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.