Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8499763.1

Orthogroup ID

OG0012804

Physical Location & Seq

Genomic Coordinates Reverse (-)

1562 .. 2326

Gene Structure 765 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8499763.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 765 bp

atgaacactacgtatagtagagggttgaaaagggtgcttgttggtgaaggcattactgttgaggtaacgagagcaacagaagtttctgtgtttcatgcatctgatcttggtgtggcgatgaacggaagtgatactattgacaaggagaaaagtgagttttggccattttggcattcatattgcgcgccattagctcccattcgcgttgtagggcctgcatcgttggttgcatacaggactagaaatcctgctgctcacattgaaactaaatttatgtccaaggatataattgagttgttgccagagaaatgcttcagcagccatcgtacatacaagaagcagaagcagtcttgccccattgattctttaagtttgaaaatatctacgctggaaagaatttggaaaggctttcttggtgataggattcgacaaaaaggactgtccggatttcttgaagcaaaaatcaaagcctcaactattgttcggttcaagcttcagctggaaagggattttaggaggaaggggatactccagcaggacattgcgggatggaggaccaggtctgctgtggaaagggtttggtttgaagttttggcgacagttgaattagagaggttgaggcttagccctatcttggttaaaaagataaggccattcattatagcagattcagttgaatgggataatccttcgaatatttcctttaccaaatcccaatctatccttgtcgcttctgaagcgcttacgttggatgtgaaatggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_S26

Protein Analysis

254

Amino Acids

28.94

Weight (kDa)

9.73

Isoelectric Point (pI)

44.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012804)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47310
fragaria_vesca	FvH4_2g40681 FvH4_2g40681 FvH4_2g40681
malus_domestica	MD08G1040400.v1.1 MD15G1034900.v1.1
prunus_persica	Prupe.1G389000_v2.0.a1 Prupe.1G389000_v2.0.a1
pyrus_communis	pycom08g03260 pycom15g03210
rosa_chinensis	RchiOBHm_Chr6g0299921
rosa_multiflora	Rmu_co8499763.1_g000002
rosa_roxburghii	Rroxscaffold_7G00168270
rosa_rugosa	Rorug06G0293200
rosa_samantha	Rh6AG404600 Rh6BG412900 Rh6CG419000 Rh6DG405800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	185, 204
AccIII	TCCGGA	1 cut(s)	443
AciI	CCGC	1 cut(s)	545
AcoI	YGGCCR	1 cut(s)	161
AcsI	RAATTY	2 cut(s)	269, 396
AcuI	CTGAAG	3 cut(s)	298, 479, 756
AfaI	GTAC	1 cut(s)	328
AfeI	AGCGCT	1 cut(s)	741
AfiI	CCNNNNNNNGG	1 cut(s)	634
AgsI	TTSAA	8 cut(s)	28, 263, 376, 455, 490, 587, 605, 677
AjnI	CCWGG	1 cut(s)	557
AluBI	AGCT	3 cut(s)	194, 493, 499
AluI	AGCT	3 cut(s)	194, 493, 499
Aor13HI	TCCGGA	1 cut(s)	443
Aor51HI	AGCGCT	1 cut(s)	741
AoxI	GGCC	3 cut(s)	161, 212, 650
ApeKI	GCWGC	2 cut(s)	251, 318
ApoI	RAATTY	2 cut(s)	269, 396
Asp700I	GAANNNNTTC	1 cut(s)	311
AspLEI	GCGC	3 cut(s)	185, 187, 742
AspS9I	GGNCC	2 cut(s)	212, 555
AsuHPI	GGTGA	2 cut(s)	56, 428
AsuII	TTCGAA	1 cut(s)	692
AvaII	GGWCC	1 cut(s)	555
BalI	TGGCCA	1 cut(s)	163
BbvI	GCAGC	2 cut(s)	238, 330
BccI	CCATC	2 cut(s)	330, 543
BciT130I	CCWGG	1 cut(s)	559
BciVI	GTATCC	1 cut(s)	519
BfaI	CTAG	1 cut(s)	240
BfoI	RGCGCY	1 cut(s)	743
BfuI	GTATCC	1 cut(s)	519
BglI	GCCNNNNNGGC	1 cut(s)	169
BisI	GCNGC	2 cut(s)	252, 319
BlpI	GCTNAGC	1 cut(s)	623
BlsI	GCNGC	2 cut(s)	253, 320
Bme1390I	CCNGG	1 cut(s)	559
Bme18I	GGWCC	1 cut(s)	555
BmgT120I	GGNCC	2 cut(s)	212, 555
BmrFI	CCNGG	1 cut(s)	559
BmsI	GCATC	2 cut(s)	107, 227
BpmI	CTGGAG	1 cut(s)	515
Bpu1102I	GCTNAGC	1 cut(s)	623
Bpu14I	TTCGAA	1 cut(s)	692
BsaAI	YACGTR	1 cut(s)	12
BsaJI	CCNNGG	1 cut(s)	279
BsaWI	WCCGGW	1 cut(s)	443
Bsc4I	CCNNNNNNNGG	1 cut(s)	634
Bse3DI	GCAATG	1 cut(s)	540
BseAI	TCCGGA	1 cut(s)	443
BseBI	CCWGG	1 cut(s)	559
BseDI	CCNNGG	1 cut(s)	279
BseGI	GGATG	2 cut(s)	554, 757
BseLI	CCNNNNNNNGG	1 cut(s)	634
BseMI	GCAATG	1 cut(s)	540
BsePI	GCGCGC	1 cut(s)	183
BseXI	GCAGC	2 cut(s)	238, 330
Bsh1236I	CGCG	2 cut(s)	185, 204
BshFI	GGCC	3 cut(s)	163, 214, 652
BsiSI	CCGG	1 cut(s)	444
BslI	CCNNNNNNNGG	1 cut(s)	634
BsmI	GAATGC	1 cut(s)	172
BsnI	GGCC	3 cut(s)	163, 214, 652
Bsp119I	TTCGAA	1 cut(s)	692
Bsp13I	TCCGGA	1 cut(s)	443
Bsp143I	GATC	1 cut(s)	103
Bsp1720I	GCTNAGC	1 cut(s)	623
BspACI	CCGC	1 cut(s)	545
BspANI	GGCC	3 cut(s)	163, 214, 652
BspEI	TCCGGA	1 cut(s)	443
BspFNI	CGCG	2 cut(s)	185, 204
BspT104I	TTCGAA	1 cut(s)	692
BsrDI	GCAATG	1 cut(s)	540
BssECI	CCNNGG	1 cut(s)	279
BssHII	GCGCGC	1 cut(s)	183
BssMI	GATC	1 cut(s)	103
BssT1I	CCWWGG	1 cut(s)	279
Bst2UI	CCWGG	1 cut(s)	559
Bst4CI	ACNGT	3 cut(s)	58, 441, 601
BstBAI	YACGTR	1 cut(s)	12
BstBI	TTCGAA	1 cut(s)	692
BstC8I	GCNNGC	2 cut(s)	185, 216
BstDEI	CTNAG	1 cut(s)	623
BstF5I	GGATG	2 cut(s)	554, 757
BstFNI	CGCG	2 cut(s)	185, 204
BstH2I	RGCGCY	1 cut(s)	743
BstHHI	GCGC	3 cut(s)	185, 187, 742
BstKTI	GATC	1 cut(s)	106
BstMBI	GATC	1 cut(s)	103
BstMWI	GCNNNNNNNGC	4 cut(s)	169, 191, 318, 737
BstNI	CCWGG	1 cut(s)	559
BstSCI	CCNGG	1 cut(s)	557
BstSNI	TACGTA	1 cut(s)	12
BstUI	CGCG	2 cut(s)	185, 204
BstV1I	GCAGC	2 cut(s)	238, 330
BsuI	GTATCC	1 cut(s)	519
BsuRI	GGCC	3 cut(s)	163, 214, 652
BtgZI	GCGATG	1 cut(s)	131
BtsCI	GGATG	2 cut(s)	554, 757
Cac8I	GCNNGC	2 cut(s)	185, 216
CfoI	GCGC	3 cut(s)	185, 187, 742
Cfr13I	GGNCC	2 cut(s)	212, 555
CsiI	ACCWGGT	1 cut(s)	557
Csp6I	GTAC	1 cut(s)	327
CviAII	CATG	1 cut(s)	95
CviQI	GTAC	1 cut(s)	327
DdeI	CTNAG	1 cut(s)	623
DpnI	GATC	1 cut(s)	105
DpnII	GATC	1 cut(s)	103
EaeI	YGGCCR	1 cut(s)	161
Eco105I	TACGTA	1 cut(s)	12
Eco130I	CCWWGG	1 cut(s)	279
Eco47I	GGWCC	1 cut(s)	555
Eco47III	AGCGCT	1 cut(s)	741
Eco57I	CTGAAG	3 cut(s)	298, 479, 756
EcoO109I	RGGNCCY	1 cut(s)	212
EcoRII	CCWGG	1 cut(s)	557
EcoT14I	CCWWGG	1 cut(s)	279
EcoT22I	ATGCAT	1 cut(s)	100
ErhI	CCWWGG	1 cut(s)	279
FaeI	CATG	1 cut(s)	98
FaiI	YATR	8 cut(s)	15, 96, 178, 232, 275, 287, 331, 662
FalI	AAGNNNNNCTT	2 cut(s)	396, 428
FatI	CATG	1 cut(s)	94
FauI	CCCGC	1 cut(s)	538
Fnu4HI	GCNGC	2 cut(s)	252, 319
FokI	GGATG	1 cut(s)	561
Fsp4HI	GCNGC	2 cut(s)	252, 319
FspBI	CTAG	1 cut(s)	240
GlaI	GCGC	3 cut(s)	184, 186, 741
GluI	GCNGC	2 cut(s)	252, 319
GsuI	CTGGAG	1 cut(s)	515
HaeII	RGCGCY	1 cut(s)	743
HaeIII	GGCC	3 cut(s)	163, 214, 652
HapII	CCGG	1 cut(s)	444
HhaI	GCGC	3 cut(s)	185, 187, 742
Hin1II	CATG	1 cut(s)	98
Hin6I	GCGC	3 cut(s)	183, 185, 740
HinP1I	GCGC	3 cut(s)	183, 185, 740
HindIII	AAGCTT	1 cut(s)	491
HinfI	GANTC	3 cut(s)	362, 424, 668
HpaII	CCGG	1 cut(s)	444
HphI	GGTGA	2 cut(s)	56, 428
Hpy188I	TCNGA	2 cut(s)	103, 736
Hpy188III	TCNNGA	2 cut(s)	444, 452
HpyAV	CCTTC	3 cut(s)	41, 514, 699
HpyCH4III	ACNGT	3 cut(s)	58, 441, 601
HpyCH4IV	ACGT	2 cut(s)	11, 746
HpyCH4V	TGCA	3 cut(s)	98, 218, 230
HpyF10VI	GCNNNNNNNGC	4 cut(s)	169, 191, 318, 737
HpyF3I	CTNAG	1 cut(s)	623
HpySE526I	ACGT	2 cut(s)	11, 746
Hsp92II	CATG	1 cut(s)	98
HspAI	GCGC	3 cut(s)	183, 185, 740
Kpn2I	TCCGGA	1 cut(s)	443
Kzo9I	GATC	1 cut(s)	103
LmnI	GCTCC	1 cut(s)	199
Lsp1109I	GCAGC	2 cut(s)	238, 330
LweI	GCATC	2 cut(s)	107, 227
MabI	ACCWGGT	1 cut(s)	557
MaeI	CTAG	1 cut(s)	240
MaeII	ACGT	2 cut(s)	11, 746
MaeIII	GTNAC	1 cut(s)	64
MalI	GATC	1 cut(s)	105
MboI	GATC	1 cut(s)	103
MlsI	TGGCCA	1 cut(s)	163
MluCI	AATT	4 cut(s)	269, 288, 396, 605
MluNI	TGGCCA	1 cut(s)	163
MmeI	TCCRAC	1 cut(s)	729
MnlI	CCTC	7 cut(s)	14, 55, 481, 510, 546, 606, 612
Mox20I	TGGCCA	1 cut(s)	163
Mph1103I	ATGCAT	1 cut(s)	100
MroI	TCCGGA	1 cut(s)	443
MroXI	GAANNNNTTC	1 cut(s)	311
MscI	TGGCCA	1 cut(s)	163
MseI	TTAA	2 cut(s)	368, 639
Msp20I	TGGCCA	1 cut(s)	163
MspA1I	CMGCKG	1 cut(s)	499
MspI	CCGG	1 cut(s)	444
MspR9I	CCNGG	1 cut(s)	559
Mva1269I	GAATGC	1 cut(s)	172
MvaI	CCWGG	1 cut(s)	559
MvnI	CGCG	2 cut(s)	185, 204
MwoI	GCNNNNNNNGC	4 cut(s)	169, 191, 318, 737
NdeII	GATC	1 cut(s)	103
NlaIII	CATG	1 cut(s)	98
NsiI	ATGCAT	1 cut(s)	100
NspV	TTCGAA	1 cut(s)	692
PauI	GCGCGC	1 cut(s)	183
PctI	GAATGC	1 cut(s)	172
PdmI	GAANNNNTTC	1 cut(s)	311
PfeI	GAWTC	3 cut(s)	362, 424, 668
PflFI	GACNNNGTC	1 cut(s)	559
PkrI	GCNGC	2 cut(s)	253, 320
Ppu21I	YACGTR	1 cut(s)	12
Psp6I	CCWGG	1 cut(s)	557
PspGI	CCWGG	1 cut(s)	557
PspPI	GGNCC	2 cut(s)	212, 555
PsyI	GACNNNGTC	1 cut(s)	559
PteI	GCGCGC	1 cut(s)	183
PvuII	CAGCTG	1 cut(s)	499
RsaI	GTAC	1 cut(s)	328
RsaNI	GTAC	1 cut(s)	327
SaqAI	TTAA	2 cut(s)	368, 639
SatI	GCNGC	2 cut(s)	252, 319
Sau3AI	GATC	1 cut(s)	103
Sau96I	GGNCC	2 cut(s)	212, 555
ScrFI	CCNGG	1 cut(s)	559
SetI	ASST	8 cut(s)	14, 66, 196, 495, 501, 563, 617, 749
SexAI	ACCWGGT	1 cut(s)	557
SfaNI	GCATC	2 cut(s)	107, 227
SfuI	TTCGAA	1 cut(s)	692
SinI	GGWCC	1 cut(s)	555
SnaBI	TACGTA	1 cut(s)	12
Sse9I	AATT	4 cut(s)	269, 288, 396, 605
SsiI	CCGC	1 cut(s)	545
SspI	AATATT	1 cut(s)	697
SspMI	CTAG	1 cut(s)	240
StyD4I	CCNGG	1 cut(s)	557
StyI	CCWWGG	1 cut(s)	279
TaaI	ACNGT	3 cut(s)	58, 441, 601
TaiI	ACGT	2 cut(s)	14, 749
TaqI	TCGA	2 cut(s)	427, 692
TasI	AATT	4 cut(s)	269, 288, 396, 605
TfiI	GAWTC	3 cut(s)	362, 424, 668
Tru1I	TTAA	2 cut(s)	368, 639
Tru9I	TTAA	2 cut(s)	368, 639
TseI	GCWGC	2 cut(s)	251, 318
TspDTI	ATGAA	5 cut(s)	17, 83, 134, 165, 646
TspGWI	ACGGA	1 cut(s)	138
Tth111I	GACNNNGTC	1 cut(s)	559
VpaK11BI	GGWCC	1 cut(s)	555
XapI	RAATTY	2 cut(s)	269, 396
XcmI	CCANNNNNNNNNTGG	1 cut(s)	565
XmnI	GAANNNNTTC	1 cut(s)	311
XspI	CTAG	1 cut(s)	240
Zsp2I	ATGCAT	1 cut(s)	100

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.