Rmu_co8502183.1_g000001

GDP-fucose protein O-fucosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8502183.1
OG0011593
Physical Location & Seq
Forward (+)
617 .. 1725
1109 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8502183.1_g000001.1.cds

Sequence Viewer

Length: 819 bp
atgttcagtgattttaaggacattttcaactggaagaatttcatggaagtcttaaaagatgatatcatggttatagagtcactcccaccggagcttgcagacctgaagcctctccccagggctccagtttcctggtccaagcagcacaaagtgctcaaattcacgtacacagattccagacttgctaatgatcttggtggttcattccaaaagctacgctgccgtgcaatgtttgaggcactgagattctcacctgaaatcgaacaactagcatcaaagttggttaacagattaaagaacaacaatagtagatacattggtctccatttaagatatgaaaaggacatgctttctttcacaggctgcagtcacaatctgaccaaagacgaagatagagaactcgcaaaaataaggaaacaaacatcacactggaagcataagacgattaatagcaccaatcatagactccaaggggtatgccccatgaccccaagagaggttgctgtgtttcttgaagcaattgggtttcctttggatacaaaagtttatgtagccgctgggaagatctacgggagagatgggattagacctctgaaagataagtaccccaatttattcttccactcaaatttagcgactgaagtagagttgcaacctttcaagaacttgcagaaccagcttgctgccttggattacattttggctttggagagtgatgtgttcatttattcttttgatggaaatatggctaaagcaataaaagggcatcgacgatttgaagggttccggaagacgatcaaccccaacaagtatgtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
O-FucT

Protein Analysis

272

Amino Acids

31.55

Weight (kDa)

9.47

Isoelectric Point (pI)

32.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 786
AciI CCGC 1 cut(s) 555
AcsI RAATTY 3 cut(s) 37, 158, 628
AcuI CTGAAG 2 cut(s) 125, 660
AdeI CACNNNGTG 1 cut(s) 151
AfaI GTAC 2 cut(s) 167, 605
AfiI CCNNNNNNNGG 1 cut(s) 496
AgsI TTSAA 4 cut(s) 28, 515, 661, 779
AjnI CCWGG 2 cut(s) 116, 131
AjuI GAANNNNNNNTTGG 2 cut(s) 602, 634
AluBI AGCT 3 cut(s) 94, 214, 679
AluI AGCT 3 cut(s) 94, 214, 679
Alw21I GWGCWC 1 cut(s) 156
Alw26I GTCTC 1 cut(s) 326
Aor13HI TCCGGA 1 cut(s) 786
ApeKI GCWGC 4 cut(s) 142, 219, 363, 683
ApoI RAATTY 3 cut(s) 37, 158, 628
AseI ATTAAT 1 cut(s) 447
Asp700I GAANNNNTTC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 243
AvaII GGWCC 1 cut(s) 135
BaeI ACNNNNGTAYC 4 cut(s) 304, 337, 528, 561
BanII GRGCYC 1 cut(s) 124
BbsI GAAGAC 1 cut(s) 797
Bbv12I GWGCWC 1 cut(s) 156
BbvI GCAGC 4 cut(s) 154, 206, 350, 670
BccI CCATC 2 cut(s) 572, 731
BceAI ACGGC 1 cut(s) 207
BciT130I CCWGG 2 cut(s) 118, 133
BciVI GTATCC 1 cut(s) 529
BcoDI GTCTC 1 cut(s) 326
BfaI CTAG 1 cut(s) 269
BfmI CTRYAG 1 cut(s) 364
BfuI GTATCC 1 cut(s) 529
BglII AGATCT 1 cut(s) 564
BisI GCNGC 5 cut(s) 143, 220, 364, 555, 684
BlsI GCNGC 5 cut(s) 144, 221, 365, 556, 685
Bme1390I CCNGG 2 cut(s) 118, 133
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 135
BmiI GGNNCC 2 cut(s) 123, 785
BmrFI CCNGG 2 cut(s) 118, 133
BmsI GCATC 2 cut(s) 281, 775
BpiI GAAGAC 1 cut(s) 797
BpmI CTGGAG 1 cut(s) 108
BsaAI YACGTR 1 cut(s) 165
BsaI GGTCTC 1 cut(s) 326
BsaJI CCNNGG 4 cut(s) 116, 117, 469, 687
BsaWI WCCGGW 2 cut(s) 88, 786
Bsc4I CCNNNNNNNGG 1 cut(s) 496
Bse1I ACTGG 3 cut(s) 35, 125, 434
Bse3DI GCAATG 1 cut(s) 234
BseAI TCCGGA 1 cut(s) 786
BseBI CCWGG 2 cut(s) 118, 133
BseDI CCNNGG 4 cut(s) 116, 117, 469, 687
BseLI CCNNNNNNNGG 1 cut(s) 496
BseMI GCAATG 1 cut(s) 234
BseMII CTCAG 1 cut(s) 233
BseNI ACTGG 3 cut(s) 35, 125, 434
BseXI GCAGC 4 cut(s) 154, 206, 350, 670
BseYI CCCAGC 1 cut(s) 557
BsiHKAI GWGCWC 1 cut(s) 156
BsiSI CCGG 2 cut(s) 89, 787
BslI CCNNNNNNNGG 1 cut(s) 496
BsmAI GTCTC 1 cut(s) 326
Bso31I GGTCTC 1 cut(s) 326
Bsp1286I GDGCHC 2 cut(s) 124, 156
Bsp13I TCCGGA 1 cut(s) 786
Bsp143I GATC 3 cut(s) 190, 564, 795
BspACI CCGC 1 cut(s) 555
BspCNI CTCAG 1 cut(s) 234
BspEI TCCGGA 1 cut(s) 786
BspLI GGNNCC 2 cut(s) 123, 785
BspMAI CTGCAG 1 cut(s) 368
BspTNI GGTCTC 1 cut(s) 326
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 3 cut(s) 35, 125, 434
BssECI CCNNGG 4 cut(s) 116, 117, 469, 687
BssMI GATC 3 cut(s) 190, 564, 795
BssT1I CCWWGG 2 cut(s) 469, 687
Bst2UI CCWGG 2 cut(s) 118, 133
BstAPI GCANNNNNTGC 1 cut(s) 151
BstBAI YACGTR 1 cut(s) 165
BstC8I GCNNGC 2 cut(s) 96, 681
BstDEI CTNAG 1 cut(s) 242
BstKTI GATC 3 cut(s) 193, 567, 798
BstMAI GTCTC 1 cut(s) 326
BstMBI GATC 3 cut(s) 190, 564, 795
BstMWI GCNNNNNNNGC 2 cut(s) 151, 676
BstNI CCWGG 2 cut(s) 118, 133
BstNSI RCATGY 1 cut(s) 349
BstSCI CCNGG 2 cut(s) 116, 131
BstSFI CTRYAG 1 cut(s) 364
BstV1I GCAGC 4 cut(s) 154, 206, 350, 670
BstV2I GAAGAC 1 cut(s) 797
BstX2I RGATCY 1 cut(s) 564
BstXI CCANNNNNNTGG 1 cut(s) 132
BstYI RGATCY 1 cut(s) 564
BsuI GTATCC 1 cut(s) 529
BtsIMutI CAGTG 3 cut(s) 13, 239, 427
Cac8I GCNNGC 2 cut(s) 96, 681
Cfr13I GGNCC 1 cut(s) 135
Csp6I GTAC 2 cut(s) 166, 604
CviAII CATG 4 cut(s) 43, 67, 346, 484
CviJI RGCY 9 cut(s) 94, 109, 122, 214, 363, 554, 679, 704, 749
CviKI_1 RGCY 9 cut(s) 94, 109, 122, 214, 363, 554, 679, 704, 749
CviQI GTAC 2 cut(s) 166, 604
DdeI CTNAG 1 cut(s) 242
DpnI GATC 3 cut(s) 192, 566, 797
DpnII GATC 3 cut(s) 190, 564, 795
DraIII CACNNNGTG 1 cut(s) 151
Eco130I CCWWGG 2 cut(s) 469, 687
Eco24I GRGCYC 1 cut(s) 124
Eco31I GGTCTC 1 cut(s) 326
Eco32I GATATC 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 135
Eco57I CTGAAG 2 cut(s) 125, 660
EcoRII CCWGG 2 cut(s) 116, 131
EcoRV GATATC 1 cut(s) 64
EcoT14I CCWWGG 2 cut(s) 469, 687
EcoT38I GRGCYC 1 cut(s) 124
ErhI CCWWGG 2 cut(s) 469, 687
FaeI CATG 4 cut(s) 46, 70, 349, 487
FatI CATG 4 cut(s) 42, 66, 345, 483
Fnu4HI GCNGC 5 cut(s) 143, 220, 364, 555, 684
FriOI GRGCYC 1 cut(s) 124
Fsp4HI GCNGC 5 cut(s) 143, 220, 364, 555, 684
FspBI CTAG 1 cut(s) 269
GluI GCNGC 5 cut(s) 143, 220, 364, 555, 684
GsaI CCCAGC 1 cut(s) 561
GsuI CTGGAG 1 cut(s) 108
HapII CCGG 2 cut(s) 89, 787
Hin1II CATG 4 cut(s) 46, 70, 349, 487
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HinfI GANTC 4 cut(s) 77, 173, 246, 465
HpaI GTTAAC 1 cut(s) 286
HpaII CCGG 2 cut(s) 89, 787
HphI GGTGA 1 cut(s) 243
Hpy166II GTNNAC 2 cut(s) 168, 286
Hpy188I TCNGA 2 cut(s) 378, 594
Hpy188III TCNNGA 4 cut(s) 177, 512, 661, 787
Hpy8I GTNNAC 2 cut(s) 168, 286
Hpy99I CGWCG 1 cut(s) 774
HpyAV CCTTC 1 cut(s) 773
HpyCH4IV ACGT 1 cut(s) 164
HpyCH4V TGCA 5 cut(s) 98, 227, 366, 652, 670
HpyF10VI GCNNNNNNNGC 2 cut(s) 151, 676
HpyF3I CTNAG 1 cut(s) 242
HpySE526I ACGT 1 cut(s) 164
Hsp92II CATG 4 cut(s) 46, 70, 349, 487
Kpn2I TCCGGA 1 cut(s) 786
KspAI GTTAAC 1 cut(s) 286
Kzo9I GATC 3 cut(s) 190, 564, 795
LmnI GCTCC 2 cut(s) 91, 127
Lsp1109I GCAGC 4 cut(s) 154, 206, 350, 670
LweI GCATC 2 cut(s) 281, 775
MaeI CTAG 1 cut(s) 269
MaeII ACGT 1 cut(s) 164
MaeIII GTNAC 2 cut(s) 78, 368
MalI GATC 3 cut(s) 192, 566, 797
MboI GATC 3 cut(s) 190, 564, 795
MboII GAAGA 5 cut(s) 46, 401, 574, 610, 802
MfeI CAATTG 1 cut(s) 519
MflI RGATCY 1 cut(s) 564
MhlI GDGCHC 2 cut(s) 124, 156
MluCI AATT 5 cut(s) 37, 158, 519, 610, 628
MlyI GAGTC 2 cut(s) 86, 459
MnlI CCTC 4 cut(s) 120, 229, 490, 600
MroI TCCGGA 1 cut(s) 786
MroXI GAANNNNTTC 1 cut(s) 38
MseI TTAA 6 cut(s) 15, 53, 285, 293, 329, 447
MspA1I CMGCKG 1 cut(s) 557
MspI CCGG 2 cut(s) 89, 787
MspR9I CCNGG 2 cut(s) 118, 133
MunI CAATTG 1 cut(s) 519
MvaI CCWGG 2 cut(s) 118, 133
MwoI GCNNNNNNNGC 2 cut(s) 151, 676
NdeII GATC 3 cut(s) 190, 564, 795
NlaIII CATG 4 cut(s) 46, 70, 349, 487
NlaIV GGNNCC 2 cut(s) 123, 785
NmuCI GTSAC 2 cut(s) 78, 368
NspI RCATGY 1 cut(s) 349
PasI CCCWGGG 1 cut(s) 117
PdmI GAANNNNTTC 1 cut(s) 38
PfeI GAWTC 2 cut(s) 173, 246
PkrI GCNGC 5 cut(s) 144, 221, 365, 556, 685
PleI GAGTC 2 cut(s) 85, 459
PpsI GAGTC 2 cut(s) 85, 459
Ppu21I YACGTR 1 cut(s) 165
PshBI ATTAAT 1 cut(s) 447
Psp6I CCWGG 2 cut(s) 116, 131
PspFI CCCAGC 1 cut(s) 557
PspGI CCWGG 2 cut(s) 116, 131
PspN4I GGNNCC 2 cut(s) 123, 785
PspPI GGNCC 1 cut(s) 135
PstI CTGCAG 1 cut(s) 368
PsuI RGATCY 1 cut(s) 564
RsaI GTAC 2 cut(s) 167, 605
RsaNI GTAC 2 cut(s) 166, 604
SaqAI TTAA 6 cut(s) 15, 53, 285, 293, 329, 447
SatI GCNGC 5 cut(s) 143, 220, 364, 555, 684
Sau3AI GATC 3 cut(s) 190, 564, 795
Sau96I GGNCC 1 cut(s) 135
SchI GAGTC 2 cut(s) 86, 459
ScrFI CCNGG 2 cut(s) 118, 133
SduI GDGCHC 2 cut(s) 124, 156
SetI ASST 9 cut(s) 96, 105, 167, 216, 256, 501, 592, 658, 681
SfaNI GCATC 2 cut(s) 281, 775
SfcI CTRYAG 1 cut(s) 364
SinI GGWCC 1 cut(s) 135
Sse9I AATT 5 cut(s) 37, 158, 519, 610, 628
SsiI CCGC 1 cut(s) 555
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 2 cut(s) 116, 131
StyI CCWWGG 2 cut(s) 469, 687
TaiI ACGT 1 cut(s) 167
TaqI TCGA 2 cut(s) 261, 769
TasI AATT 5 cut(s) 37, 158, 519, 610, 628
TauI GCSGC 1 cut(s) 557
TfiI GAWTC 2 cut(s) 173, 246
Tru1I TTAA 6 cut(s) 15, 53, 285, 293, 329, 447
Tru9I TTAA 6 cut(s) 15, 53, 285, 293, 329, 447
TscAI CASTG 3 cut(s) 13, 246, 434
TseFI GTSAC 2 cut(s) 78, 368
TseI GCWGC 4 cut(s) 142, 219, 363, 683
Tsp45I GTSAC 2 cut(s) 78, 368
TspDTI ATGAA 4 cut(s) 31, 192, 351, 712
TspRI CASTG 3 cut(s) 13, 246, 434
VpaK11BI GGWCC 1 cut(s) 135
VspI ATTAAT 1 cut(s) 447
XapI RAATTY 3 cut(s) 37, 158, 628
XceI RCATGY 1 cut(s) 349
XmnI GAANNNNTTC 1 cut(s) 38
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.