Rmu_co8519037.1_g000002

WEB family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8519037.1
Physical Location & Seq
Forward (+)
1990 .. 2751
762 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8519037.1_g000002.1.cds

Sequence Viewer

Length: 762 bp
atggagacccaaaatcttcaaacccttccagtacctcatgattaccacgccaatgttgacagttcacgacccttccgctccgtcaaggaagctgttgccgtctttggagagcggcttctcctcggagagttcttctcatcaccatcccctaaaccgccgcagctgctgccatgttacaccgagcaagaagtagaaacttcttcaccaaggaacaagtctgtcatctcatcaccaagtactagtgctgatccacatagtaaagaaagtgataatgttttggatagtctcaagaaacttgaggctgagcttgaggaaacaaaggtggagttgaagatgctcaaggagagagagtccgaaaccgaggtggccttggcaaccttgaatgcagagcttcacaagaacatgtccaagttggctcaggctgaggcggccgcagcagcaaaagcagcggctagtagtgatcaccatgttatcagttcgatgagatcaaattcggaggaagcagagaagagtgttaagaaggatcagtggtcgatgataaggatggaggacactactactttggctcagatattaagcattagttctcaacatgagaatcaaggtggttattatgggagcggaggaaaaagagagaggaattataagatgatgaagaagaagcctattgttcctcttctgcaggacttgttttcctggaaaaaggggtcgtctactcctctccatgaccatatttattcgtctccgaaactctactattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

253

Amino Acids

28.25

Weight (kDa)

6.33

Isoelectric Point (pI)

57.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015330)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 645
AccBSI CCGCTC 3 cut(s) 78, 112, 621
AccI GTMKAC 1 cut(s) 713
AciI CCGC 8 cut(s) 76, 112, 155, 158, 428, 432, 449, 621
AclWI GGATC 2 cut(s) 242, 531
AcoI YGGCCR 1 cut(s) 429
AcsI RAATTY 1 cut(s) 490
AfaI GTAC 2 cut(s) 33, 238
AflIII ACRYGT 1 cut(s) 402
AgsI TTSAA 3 cut(s) 20, 331, 382
AhlI ACTAGT 1 cut(s) 239
AjnI CCWGG 1 cut(s) 695
AluBI AGCT 4 cut(s) 92, 163, 307, 391
AluI AGCT 4 cut(s) 92, 163, 307, 391
Alw26I GTCTC 2 cut(s) 290, 747
AlwI GGATC 2 cut(s) 242, 531
AlwNI CAGNNNCTG 1 cut(s) 166
AoxI GGCC 2 cut(s) 366, 429
ApeKI GCWGC 6 cut(s) 160, 163, 166, 434, 437, 446
ApoI RAATTY 1 cut(s) 490
AsuHPI GGTGA 4 cut(s) 132, 195, 222, 455
BbvCI CCTCAGC 1 cut(s) 423
BbvI GCAGC 6 cut(s) 150, 153, 172, 446, 449, 458
BccI CCATC 2 cut(s) 151, 538
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 697
BclI TGATCA 1 cut(s) 460
BcoDI GTCTC 2 cut(s) 290, 747
BcuI ACTAGT 1 cut(s) 239
BfaI CTAG 2 cut(s) 240, 453
BfmI CTRYAG 1 cut(s) 680
BlpI GCTNAGC 1 cut(s) 303
BmcAI AGTACT 1 cut(s) 238
Bme1390I CCNGG 1 cut(s) 697
BmrFI CCNGG 1 cut(s) 697
BmsI GCATC 1 cut(s) 324
BplI GAGNNNNNCTC 2 cut(s) 119, 151
Bpu10I CCTNAGC 2 cut(s) 417, 423
Bpu1102I GCTNAGC 1 cut(s) 303
BpuEI CTTGAG 4 cut(s) 272, 317, 323, 329
BsaJI CCNNGG 4 cut(s) 121, 206, 360, 369
BsaXI ACNNNNNCTCC 2 cut(s) 335, 365
Bse1I ACTGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 697
BseDI CCNNGG 4 cut(s) 121, 206, 360, 369
BseGI GGATG 2 cut(s) 143, 549
BseMII CTCAG 4 cut(s) 294, 414, 431, 581
BseNI ACTGG 1 cut(s) 29
BseRI GAGGAG 2 cut(s) 110, 708
BseX3I CGGCCG 1 cut(s) 429
BseXI GCAGC 6 cut(s) 150, 153, 172, 446, 449, 458
Bsh1285I CGRYCG 1 cut(s) 432
BshFI GGCC 2 cut(s) 368, 431
BsiEI CGRYCG 1 cut(s) 432
BsmAI GTCTC 2 cut(s) 290, 747
BsmBI CGTCTC 1 cut(s) 747
BsmI GAATGC 1 cut(s) 388
BsnI GGCC 2 cut(s) 368, 431
Bsp143I GATC 4 cut(s) 247, 460, 485, 523
Bsp1720I GCTNAGC 1 cut(s) 303
BspACI CCGC 8 cut(s) 76, 112, 155, 158, 428, 432, 449, 621
BspANI GGCC 2 cut(s) 368, 431
BspCNI CTCAG 4 cut(s) 295, 415, 430, 580
BspHI TCATGA 1 cut(s) 37
BspMAI CTGCAG 1 cut(s) 684
BspPI GGATC 2 cut(s) 242, 531
BsrBI CCGCTC 3 cut(s) 78, 112, 621
BsrI ACTGG 1 cut(s) 29
BssECI CCNNGG 4 cut(s) 121, 206, 360, 369
BssMI GATC 4 cut(s) 247, 460, 485, 523
BssT1I CCWWGG 2 cut(s) 206, 369
Bst2UI CCWGG 1 cut(s) 697
Bst4CI ACNGT 1 cut(s) 62
Bst6I CTCTTC 2 cut(s) 503, 681
BstAPI GCANNNNNTGC 1 cut(s) 166
BstDEI CTNAG 4 cut(s) 303, 417, 423, 567
BstF5I GGATG 2 cut(s) 143, 549
BstKTI GATC 4 cut(s) 250, 463, 488, 526
BstMAI GTCTC 2 cut(s) 290, 747
BstMBI GATC 4 cut(s) 247, 460, 485, 523
BstMCI CGRYCG 1 cut(s) 432
BstMWI GCNNNNNNNGC 7 cut(s) 163, 166, 428, 434, 437, 443, 446
BstNI CCWGG 1 cut(s) 697
BstNSI RCATGY 1 cut(s) 406
BstSCI CCNGG 1 cut(s) 695
BstSFI CTRYAG 1 cut(s) 680
BstV1I GCAGC 6 cut(s) 150, 153, 172, 446, 449, 458
BstZI CGGCCG 1 cut(s) 429
BsuRI GGCC 2 cut(s) 368, 431
BtsCI GGATG 2 cut(s) 143, 549
BtsIMutI CAGTG 1 cut(s) 533
CaiI CAGNNNCTG 1 cut(s) 166
CciI TCATGA 1 cut(s) 37
CciNI GCGGCCGC 1 cut(s) 429
Csp6I GTAC 2 cut(s) 32, 237
CviAII CATG 6 cut(s) 38, 171, 403, 467, 593, 725
CviQI GTAC 2 cut(s) 32, 237
DdeI CTNAG 4 cut(s) 303, 417, 423, 567
DpnI GATC 4 cut(s) 249, 462, 487, 525
DpnII GATC 4 cut(s) 247, 460, 485, 523
EaeI YGGCCR 1 cut(s) 429
EagI CGGCCG 1 cut(s) 429
Eam1104I CTCTTC 2 cut(s) 503, 681
EarI CTCTTC 2 cut(s) 503, 681
EclXI CGGCCG 1 cut(s) 429
Eco130I CCWWGG 2 cut(s) 206, 369
Eco52I CGGCCG 1 cut(s) 429
EcoRII CCWGG 1 cut(s) 695
EcoT14I CCWWGG 2 cut(s) 206, 369
ErhI CCWWGG 2 cut(s) 206, 369
Esp3I CGTCTC 1 cut(s) 747
FaeI CATG 6 cut(s) 41, 174, 406, 470, 596, 728
FatI CATG 6 cut(s) 37, 170, 402, 466, 592, 724
FbaI TGATCA 1 cut(s) 460
FblI GTMKAC 1 cut(s) 713
FokI GGATG 2 cut(s) 130, 556
FspBI CTAG 2 cut(s) 240, 453
HaeIII GGCC 2 cut(s) 368, 431
Hin1II CATG 6 cut(s) 41, 174, 406, 470, 596, 728
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HinfI GANTC 2 cut(s) 350, 598
HphI GGTGA 4 cut(s) 132, 195, 222, 455
Hpy166II GTNNAC 3 cut(s) 58, 65, 714
Hpy188I TCNGA 5 cut(s) 125, 355, 496, 570, 747
Hpy188III TCNNGA 3 cut(s) 38, 66, 289
Hpy8I GTNNAC 3 cut(s) 58, 65, 714
HpyAV CCTTC 3 cut(s) 35, 82, 514
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 386, 682
HpyF10VI GCNNNNNNNGC 7 cut(s) 163, 166, 428, 434, 437, 443, 446
HpyF3I CTNAG 4 cut(s) 303, 417, 423, 567
Hsp92II CATG 6 cut(s) 41, 174, 406, 470, 596, 728
Ksp22I TGATCA 1 cut(s) 460
Kzo9I GATC 4 cut(s) 247, 460, 485, 523
LmnI GCTCC 2 cut(s) 83, 618
LpnPI CCDG 5 cut(s) 42, 404, 668, 682, 709
Lsp1109I GCAGC 6 cut(s) 150, 153, 172, 446, 449, 458
LweI GCATC 1 cut(s) 324
MaeI CTAG 2 cut(s) 240, 453
MaeIII GTNAC 1 cut(s) 173
MalI GATC 4 cut(s) 249, 462, 487, 525
MbiI CCGCTC 3 cut(s) 78, 112, 621
MboI GATC 4 cut(s) 247, 460, 485, 523
MboII GAAGA 8 cut(s) 8, 124, 192, 343, 520, 667, 668, 670
MluCI AATT 2 cut(s) 490, 640
MlyI GAGTC 1 cut(s) 359
MseI TTAA 2 cut(s) 516, 575
MslI CAYNNNNRTG 1 cut(s) 51
MspA1I CMGCKG 2 cut(s) 163, 449
MspR9I CCNGG 1 cut(s) 697
Mva1269I GAATGC 1 cut(s) 388
MvaI CCWGG 1 cut(s) 697
MwoI GCNNNNNNNGC 7 cut(s) 163, 166, 428, 434, 437, 443, 446
NdeII GATC 4 cut(s) 247, 460, 485, 523
NlaIII CATG 6 cut(s) 41, 174, 406, 470, 596, 728
NotI GCGGCCGC 1 cut(s) 429
NspI RCATGY 1 cut(s) 406
PagI TCATGA 1 cut(s) 37
PciI ACATGT 1 cut(s) 402
PctI GAATGC 1 cut(s) 388
PfeI GAWTC 1 cut(s) 598
PfoI TCCNGGA 1 cut(s) 695
PleI GAGTC 1 cut(s) 358
PpsI GAGTC 1 cut(s) 358
PscI ACATGT 1 cut(s) 402
PsiI TTATAA 1 cut(s) 645
Psp6I CCWGG 1 cut(s) 695
PspGI CCWGG 1 cut(s) 695
PstI CTGCAG 1 cut(s) 684
PstNI CAGNNNCTG 1 cut(s) 166
PvuII CAGCTG 1 cut(s) 163
RsaI GTAC 2 cut(s) 33, 238
RsaNI GTAC 2 cut(s) 32, 237
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 2 cut(s) 516, 575
Sau3AI GATC 4 cut(s) 247, 460, 485, 523
ScaI AGTACT 1 cut(s) 238
SchI GAGTC 1 cut(s) 359
ScrFI CCNGG 1 cut(s) 697
SetI ASST 9 cut(s) 37, 94, 165, 309, 324, 366, 380, 393, 607
SfaNI GCATC 1 cut(s) 324
SfcI CTRYAG 1 cut(s) 680
SmiMI CAYNNNNRTG 1 cut(s) 51
SmlI CTYRAG 4 cut(s) 287, 296, 308, 338
SmoI CTYRAG 4 cut(s) 287, 296, 308, 338
SpeI ACTAGT 1 cut(s) 239
Sse9I AATT 2 cut(s) 490, 640
SsiI CCGC 8 cut(s) 76, 112, 155, 158, 428, 432, 449, 621
SspMI CTAG 2 cut(s) 240, 453
StyD4I CCNGG 1 cut(s) 695
StyI CCWWGG 2 cut(s) 206, 369
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 2 cut(s) 479, 533
TasI AATT 2 cut(s) 490, 640
TatI WGTACW 1 cut(s) 236
TauI GCSGC 5 cut(s) 115, 160, 431, 434, 452
TfiI GAWTC 1 cut(s) 598
Tru1I TTAA 2 cut(s) 516, 575
Tru9I TTAA 2 cut(s) 516, 575
TscAI CASTG 1 cut(s) 533
TseI GCWGC 6 cut(s) 160, 163, 166, 434, 437, 446
TspDTI ATGAA 1 cut(s) 668
TspGWI ACGGA 1 cut(s) 70
TspRI CASTG 1 cut(s) 533
XapI RAATTY 1 cut(s) 490
XceI RCATGY 1 cut(s) 406
XmiI GTMKAC 1 cut(s) 713
XspI CTAG 2 cut(s) 240, 453
ZrmI AGTACT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.