Rmu_sc0000015.1_g000002

Glutathione S-transferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000015.1
Physical Location & Seq
Reverse (-)
8466 .. 9454
989 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000015.1_g000002.1.cds

Sequence Viewer

Length: 663 bp
atgtcgaaggcagaggttattctattggactgttggattagccctttctgcatgagggtgaaaattgctttggaagaaaagggtgttgcatacgaaagccaggctgaggatttgtttggaggcaagagtgaacttctacttacatcaaacccccacggcaaggtgcctgtgttgctccacaatgggaaacctgtgtccgagtccgccatcatagttgcctacatcgatgaaacctggtcttcctcaccattgctcccaccttgtgccttcggtcgagctcaagcaaggttttgggctgactacattgacaaaaaggtgtttgatgcgggcaaagccatcttcatgagcaaaggagaagcagtagaggttggtaagaaggacttcattgagattataaagactctagagaaggctttgggagataaggatttctttaatggtgataccttcggtttcgtcgacatcataggcattgccatgacgagttggtttcctgcttatgagaagttcgggagcttcaagcttgaagatcattgccccaaattctcagcttggatcaagaggagctggcagagggagagtgtagccaaggtcattccagaggcagagaaggtcattgaatttgtgaccatgtttaggaagatgatgggagccgaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

220

Amino Acids

24.71

Weight (kDa)

5.56

Isoelectric Point (pI)

36.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015584)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 395
AccB1I GGYRCC 1 cut(s) 163
AccI GTMKAC 1 cut(s) 459
AciI CCGC 2 cut(s) 204, 326
AclWI GGATC 1 cut(s) 563
AcsI RAATTY 2 cut(s) 542, 620
AdeI CACNNNGTG 1 cut(s) 263
AfiI CCNNNNNNNGG 3 cut(s) 106, 160, 636
AgsI TTSAA 3 cut(s) 520, 527, 620
AjnI CCWGG 2 cut(s) 99, 233
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
AluBI AGCT 5 cut(s) 278, 516, 523, 551, 567
AluI AGCT 5 cut(s) 278, 516, 523, 551, 567
Alw21I GWGCWC 1 cut(s) 280
AlwI GGATC 1 cut(s) 563
ApoI RAATTY 2 cut(s) 542, 620
Asp700I GAANNNNTTC 1 cut(s) 380
AsuHPI GGTGA 3 cut(s) 70, 237, 452
BanI GGYRCC 1 cut(s) 163
BanII GRGCYC 1 cut(s) 280
BbsI GAAGAC 1 cut(s) 231
Bbv12I GWGCWC 1 cut(s) 280
BbvCI CCTCAGC 1 cut(s) 105
BccI CCATC 3 cut(s) 215, 344, 640
BceAI ACGGC 1 cut(s) 172
BciT130I CCWGG 2 cut(s) 101, 235
BfaI CTAG 1 cut(s) 404
Bme1390I CCNGG 2 cut(s) 101, 235
BmiI GGNNCC 2 cut(s) 165, 652
BmrFI CCNGG 2 cut(s) 101, 235
BmsI GCATC 1 cut(s) 313
BpiI GAAGAC 1 cut(s) 231
Bpu10I CCTNAGC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 264
Bsa29I ATCGAT 1 cut(s) 225
BsaJI CCNNGG 2 cut(s) 154, 588
BsaXI ACNNNNNCTCC 4 cut(s) 237, 267, 345, 375
Bsc4I CCNNNNNNNGG 3 cut(s) 106, 160, 636
Bse3DI GCAATG 3 cut(s) 248, 471, 532
BseBI CCWGG 2 cut(s) 101, 235
BseCI ATCGAT 1 cut(s) 225
BseDI CCNNGG 2 cut(s) 154, 588
BseLI CCNNNNNNNGG 3 cut(s) 106, 160, 636
BseMI GCAATG 3 cut(s) 248, 471, 532
BseMII CTCAG 2 cut(s) 96, 561
BseRI GAGGAG 1 cut(s) 577
Bsh1285I CGRYCG 1 cut(s) 274
BshNI GGYRCC 1 cut(s) 163
BshVI ATCGAT 1 cut(s) 225
BsiEI CGRYCG 1 cut(s) 274
BsiHKAI GWGCWC 1 cut(s) 280
BslI CCNNNNNNNGG 3 cut(s) 106, 160, 636
Bsp1286I GDGCHC 1 cut(s) 280
Bsp143I GATC 2 cut(s) 529, 555
BspACI CCGC 2 cut(s) 204, 326
BspCNI CTCAG 2 cut(s) 97, 560
BspDI ATCGAT 1 cut(s) 225
BspHI TCATGA 1 cut(s) 342
BspLI GGNNCC 2 cut(s) 165, 652
BspPI GGATC 1 cut(s) 563
BspT107I GGYRCC 1 cut(s) 163
BsrDI GCAATG 3 cut(s) 248, 471, 532
BssECI CCNNGG 2 cut(s) 154, 588
BssMI GATC 2 cut(s) 529, 555
BssT1I CCWWGG 1 cut(s) 588
Bst2UI CCWGG 2 cut(s) 101, 235
Bst4CI ACNGT 1 cut(s) 32
BstC8I GCNNGC 2 cut(s) 328, 569
BstDEI CTNAG 2 cut(s) 105, 547
BstDSI CCRYGG 1 cut(s) 154
BstKTI GATC 2 cut(s) 532, 558
BstMBI GATC 2 cut(s) 529, 555
BstMCI CGRYCG 1 cut(s) 274
BstMWI GCNNNNNNNGC 3 cut(s) 48, 172, 332
BstNI CCWGG 2 cut(s) 101, 235
BstSCI CCNGG 2 cut(s) 99, 233
BstV2I GAAGAC 1 cut(s) 231
Bsu15I ATCGAT 1 cut(s) 225
BsuTUI ATCGAT 1 cut(s) 225
BtgI CCRYGG 1 cut(s) 154
Cac8I GCNNGC 2 cut(s) 328, 569
CciI TCATGA 1 cut(s) 342
ClaI ATCGAT 1 cut(s) 225
CsiI ACCWGGT 1 cut(s) 233
CviAII CATG 4 cut(s) 52, 343, 478, 631
DdeI CTNAG 2 cut(s) 105, 547
DpnI GATC 2 cut(s) 531, 557
DpnII GATC 2 cut(s) 529, 555
DraIII CACNNNGTG 1 cut(s) 263
EciI GGCGGA 1 cut(s) 193
Ecl136II GAGCTC 1 cut(s) 278
Eco130I CCWWGG 1 cut(s) 588
Eco24I GRGCYC 1 cut(s) 280
Eco53kI GAGCTC 1 cut(s) 278
EcoICRI GAGCTC 1 cut(s) 278
EcoRII CCWGG 2 cut(s) 99, 233
EcoT14I CCWWGG 1 cut(s) 588
EcoT38I GRGCYC 1 cut(s) 280
ErhI CCWWGG 1 cut(s) 588
FaeI CATG 4 cut(s) 55, 346, 481, 634
FaiI YATR 9 cut(s) 53, 91, 212, 344, 395, 467, 479, 501, 632
FalI AAGNNNNNCTT 4 cut(s) 365, 397, 416, 448
FatI CATG 4 cut(s) 51, 342, 477, 630
FauI CCCGC 1 cut(s) 319
FblI GTMKAC 1 cut(s) 459
FriOI GRGCYC 1 cut(s) 280
FspBI CTAG 1 cut(s) 404
Hin1II CATG 4 cut(s) 55, 346, 481, 634
HincII GTYRAC 1 cut(s) 460
HindII GTYRAC 1 cut(s) 460
HindIII AAGCTT 1 cut(s) 521
HinfI GANTC 2 cut(s) 200, 400
HphI GGTGA 3 cut(s) 70, 237, 452
Hpy166II GTNNAC 2 cut(s) 131, 460
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 5 cut(s) 343, 404, 511, 559, 599
Hpy8I GTNNAC 2 cut(s) 131, 460
Hpy99I CGWCG 1 cut(s) 461
HpyAV CCTTC 5 cut(s) 277, 370, 403, 457, 604
HpyCH4III ACNGT 1 cut(s) 32
HpyCH4V TGCA 2 cut(s) 51, 89
HpyF10VI GCNNNNNNNGC 3 cut(s) 48, 172, 332
HpyF3I CTNAG 2 cut(s) 105, 547
Hsp92II CATG 4 cut(s) 55, 346, 481, 634
Kzo9I GATC 2 cut(s) 529, 555
LmnI GCTCC 5 cut(s) 180, 258, 513, 564, 650
LpnPI CCDG 9 cut(s) 86, 113, 180, 204, 220, 247, 507, 553, 612
LweI GCATC 1 cut(s) 313
MabI ACCWGGT 1 cut(s) 233
MaeI CTAG 1 cut(s) 404
MaeIII GTNAC 1 cut(s) 625
MalI GATC 2 cut(s) 531, 557
MboI GATC 2 cut(s) 529, 555
MboII GAAGA 5 cut(s) 86, 231, 331, 539, 652
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 3 cut(s) 63, 542, 620
MlyI GAGTC 2 cut(s) 209, 394
MmeI TCCRAC 1 cut(s) 14
MnlI CCTC 9 cut(s) 7, 48, 100, 113, 253, 358, 555, 567, 595
MroXI GAANNNNTTC 1 cut(s) 380
MseI TTAA 1 cut(s) 435
MslI CAYNNNNRTG 3 cut(s) 56, 341, 476
MspR9I CCNGG 2 cut(s) 101, 235
MvaI CCWGG 2 cut(s) 101, 235
MwoI GCNNNNNNNGC 3 cut(s) 48, 172, 332
NdeII GATC 2 cut(s) 529, 555
NlaIII CATG 4 cut(s) 55, 346, 481, 634
NlaIV GGNNCC 2 cut(s) 165, 652
NmuCI GTSAC 1 cut(s) 625
PagI TCATGA 1 cut(s) 342
PcsI WCGNNNNNNNCGW 1 cut(s) 456
PdmI GAANNNNTTC 1 cut(s) 380
PleI GAGTC 2 cut(s) 208, 394
PpsI GAGTC 2 cut(s) 208, 394
PsiI TTATAA 1 cut(s) 395
Psp124BI GAGCTC 1 cut(s) 280
Psp6I CCWGG 2 cut(s) 99, 233
PspGI CCWGG 2 cut(s) 99, 233
PspN4I GGNNCC 2 cut(s) 165, 652
RseI CAYNNNNRTG 3 cut(s) 56, 341, 476
SacI GAGCTC 1 cut(s) 280
SalI GTCGAC 1 cut(s) 458
SaqAI TTAA 1 cut(s) 435
Sau3AI GATC 2 cut(s) 529, 555
SchI GAGTC 2 cut(s) 209, 394
ScrFI CCNGG 2 cut(s) 101, 235
SduI GDGCHC 1 cut(s) 280
SexAI ACCWGGT 1 cut(s) 233
SfaNI GCATC 1 cut(s) 313
SmiMI CAYNNNNRTG 3 cut(s) 56, 341, 476
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
Sse9I AATT 3 cut(s) 63, 542, 620
SsiI CCGC 2 cut(s) 204, 326
SspMI CTAG 1 cut(s) 404
SstI GAGCTC 1 cut(s) 280
StyD4I CCNGG 2 cut(s) 99, 233
StyI CCWWGG 1 cut(s) 588
TaaI ACNGT 1 cut(s) 32
TaqI TCGA 4 cut(s) 5, 225, 274, 459
TaqII GACCGA 1 cut(s) 260
TasI AATT 3 cut(s) 63, 542, 620
Tru1I TTAA 1 cut(s) 435
Tru9I TTAA 1 cut(s) 435
TseFI GTSAC 1 cut(s) 625
Tsp45I GTSAC 1 cut(s) 625
TspDTI ATGAA 3 cut(s) 243, 331, 373
XapI RAATTY 2 cut(s) 542, 620
XbaI TCTAGA 1 cut(s) 403
XmiI GTMKAC 1 cut(s) 459
XmnI GAANNNNTTC 1 cut(s) 380
XspI CTAG 1 cut(s) 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.