Rmu_sc0000239.1_g000121

kDa class I heat shock protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000239.1
OG0017742
Physical Location & Seq
Forward (+)
677249 .. 677593
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000239.1_g000121.1.cds

Sequence Viewer

Length: 345 bp
atgtcgctcattcccaattttcgacgaaacattatcttcagcctcgatctcttggacctattcaaagatttccaattctcttcctcatcgctctccacattcgagaaaactcagctttcatgtcaccaggatcgactagaaggagaccccagaaggcaaaagcccatgtgttcaaggttgatatttcgggggccgaagaaagaagaggtcaaggttgagattgaagatgacagggtgctgcagatcagcagagaaaggaagatagaggaggacaagaacagcaagtggcatcggatcgagaaaagcagcggcaagttctcaagaaggttcgaatgcgaaagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
HSP20

Protein Analysis

114

Amino Acids

13.67

Weight (kDa)

9.12

Isoelectric Point (pI)

76.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017742)

Species Orthologous Gene IDs
malus_domestica MD11G1087200.v1.1 MD11G1089400.v1.1
rosa_chinensis RchiOBHm_Chr6g0273051
rosa_laevigata RLG00000016766
rosa_multiflora Rmu_co8398661.1_g000001 Rmu_sc0000239.1_g000121
rosa_roxburghii Rroxscaffold_7G00195690
rosa_rugosa Rorug03G0091000 Rorug06G0072600
rosa_samantha Rh6AG188200 Rh6BG191600 Rh6DG182100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 309
AclWI GGATC 2 cut(s) 138, 302
AcuI CTGAAG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 64, 174, 224
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw26I GTCTC 1 cut(s) 138
AlwI GGATC 2 cut(s) 138, 302
AoxI GGCC 1 cut(s) 191
ApeKI GCWGC 2 cut(s) 238, 306
AspS9I GGNCC 2 cut(s) 55, 191
AsuHPI GGTGA 1 cut(s) 116
AsuII TTCGAA 1 cut(s) 330
AvaII GGWCC 1 cut(s) 55
BbvI GCAGC 2 cut(s) 225, 318
BciT130I CCWGG 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 239
BisI GCNGC 3 cut(s) 239, 307, 310
BlsI GCNGC 3 cut(s) 240, 308, 311
Bme1390I CCNGG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 2 cut(s) 55, 191
BmiI GGNNCC 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 128
BmsI GCATC 1 cut(s) 298
Bpu14I TTCGAA 1 cut(s) 330
BpuEI CTTGAG 1 cut(s) 304
BsaI GGTCTC 1 cut(s) 138
BseBI CCWGG 1 cut(s) 128
BseMII CTCAG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 281
BseXI GCAGC 2 cut(s) 225, 318
BshFI GGCC 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 138
BsmI GAATGC 1 cut(s) 338
BsnI GGCC 1 cut(s) 193
Bso31I GGTCTC 1 cut(s) 138
Bsp119I TTCGAA 1 cut(s) 330
Bsp143I GATC 4 cut(s) 46, 130, 243, 294
BspACI CCGC 1 cut(s) 309
BspANI GGCC 1 cut(s) 193
BspCNI CTCAG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 192
BspMAI CTGCAG 1 cut(s) 243
BspPI GGATC 2 cut(s) 138, 302
BspT104I TTCGAA 1 cut(s) 330
BspTNI GGTCTC 1 cut(s) 138
BssMI GATC 4 cut(s) 46, 130, 243, 294
Bst2UI CCWGG 1 cut(s) 128
Bst6I CTCTTC 2 cut(s) 85, 198
BstBI TTCGAA 1 cut(s) 330
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 4 cut(s) 49, 133, 246, 297
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 4 cut(s) 46, 130, 243, 294
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 239
BstV1I GCAGC 2 cut(s) 225, 318
BsuRI GGCC 1 cut(s) 193
BtgZI GCGATG 1 cut(s) 72
Cfr13I GGNCC 2 cut(s) 55, 191
CviAII CATG 2 cut(s) 120, 166
CviJI RGCY 4 cut(s) 42, 115, 163, 193
CviKI_1 RGCY 4 cut(s) 42, 115, 163, 193
DdeI CTNAG 1 cut(s) 111
DpnI GATC 4 cut(s) 48, 132, 245, 296
DpnII GATC 4 cut(s) 46, 130, 243, 294
Eam1104I CTCTTC 2 cut(s) 85, 198
EarI CTCTTC 2 cut(s) 85, 198
Eco31I GGTCTC 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 126
FaeI CATG 2 cut(s) 123, 169
FaiI YATR 2 cut(s) 121, 167
FatI CATG 2 cut(s) 119, 165
Fnu4HI GCNGC 3 cut(s) 239, 307, 310
Fsp4HI GCNGC 3 cut(s) 239, 307, 310
FspBI CTAG 1 cut(s) 137
GluI GCNGC 3 cut(s) 239, 307, 310
HaeIII GGCC 1 cut(s) 193
Hin1II CATG 2 cut(s) 123, 169
HphI GGTGA 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 294
Hpy188III TCNNGA 3 cut(s) 103, 298, 321
Hpy99I CGWCG 1 cut(s) 27
HpyAV CCTTC 3 cut(s) 134, 147, 318
HpyCH4V TGCA 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 2 cut(s) 123, 169
Kzo9I GATC 4 cut(s) 46, 130, 243, 294
LpnPI CCDG 4 cut(s) 113, 140, 163, 217
Lsp1109I GCAGC 2 cut(s) 225, 318
LweI GCATC 1 cut(s) 298
MaeI CTAG 1 cut(s) 137
MaeIII GTNAC 1 cut(s) 122
MalI GATC 4 cut(s) 48, 132, 245, 296
MboI GATC 4 cut(s) 46, 130, 243, 294
MboII GAAGA 6 cut(s) 28, 72, 208, 215, 236, 271
MluCI AATT 2 cut(s) 16, 74
MnlI CCTC 5 cut(s) 53, 94, 199, 259, 262
MseI TTAA 1 cut(s) 343
MspA1I CMGCKG 1 cut(s) 309
MspR9I CCNGG 1 cut(s) 128
Mva1269I GAATGC 1 cut(s) 338
MvaI CCWGG 1 cut(s) 128
NdeII GATC 4 cut(s) 46, 130, 243, 294
NlaIII CATG 2 cut(s) 123, 169
NlaIV GGNNCC 1 cut(s) 192
NmuCI GTSAC 1 cut(s) 122
NspV TTCGAA 1 cut(s) 330
PctI GAATGC 1 cut(s) 338
PkrI GCNGC 3 cut(s) 240, 308, 311
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 2 cut(s) 55, 191
PstI CTGCAG 1 cut(s) 243
SaqAI TTAA 1 cut(s) 343
SatI GCNGC 3 cut(s) 239, 307, 310
Sau3AI GATC 4 cut(s) 46, 130, 243, 294
Sau96I GGNCC 2 cut(s) 55, 191
ScrFI CCNGG 1 cut(s) 128
SetI ASST 6 cut(s) 60, 117, 179, 210, 216, 329
SfaNI GCATC 1 cut(s) 298
SfcI CTRYAG 1 cut(s) 239
SfuI TTCGAA 1 cut(s) 330
SinI GGWCC 1 cut(s) 55
SmlI CTYRAG 1 cut(s) 319
SmoI CTYRAG 1 cut(s) 319
Sse9I AATT 2 cut(s) 16, 74
SsiI CCGC 1 cut(s) 309
SspMI CTAG 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 126
TaqI TCGA 6 cut(s) 22, 45, 102, 133, 297, 330
TasI AATT 2 cut(s) 16, 74
TauI GCSGC 1 cut(s) 312
Tru1I TTAA 1 cut(s) 343
Tru9I TTAA 1 cut(s) 343
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 2 cut(s) 238, 306
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 55
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.