Rmu_sc0000453.1_g000021

Belongs to the universal ribosomal protein uL14 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000453.1
Physical Location & Seq
Forward (+)
72584 .. 74539
1956 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000453.1_g000021.1.cds

Sequence Viewer

Length: 504 bp
atggctgcagctttggcttcaaagtgttctcgtgtgggccgttcgtttttggggggtcttggcaacaacttgtctggcttattgagcgcatcacatgagatgacatgcaacactttcttgtctcagcaacaaaggactttcatacaaatgaggaccattctcaaagtcgtggacaactcaggggcgaagaaggtgatgtgcatacaagctttgaaggcgagaaagaaaggggcaagattgggagacacaattgttgcatcagtcaaggaggcccatccaaatggaaaagtgaagaaaggaaaggtagtgtatggtgtggttgttcgtgctgccatgcaacgaggccgctgtgatgggagtgaggtcaagtttgatgacaatgctgtcgtactggttgacaagcagggccagccaattgggactagagtatttggacctgtcccacacgagttgagaaagaaaaagcatgttaagattcttagtttggcagagcatattgcctga

Protein Analysis

167

Amino Acids

18.0

Weight (kDa)

10.33

Isoelectric Point (pI)

16.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 383
AciI CCGC 1 cut(s) 346
AfaI GTAC 1 cut(s) 390
AgsI TTSAA 2 cut(s) 21, 214
AluBI AGCT 2 cut(s) 11, 209
AluI AGCT 2 cut(s) 11, 209
Alw26I GTCTC 2 cut(s) 126, 237
AoxI GGCC 4 cut(s) 37, 270, 343, 406
ApeKI GCWGC 3 cut(s) 5, 8, 329
AspLEI GCGC 1 cut(s) 89
AspS9I GGNCC 5 cut(s) 37, 153, 271, 406, 434
AsuHPI GGTGA 1 cut(s) 205
AvaII GGWCC 2 cut(s) 153, 434
BauI CACGAG 2 cut(s) 30, 446
BbvI GCAGC 2 cut(s) 20, 316
BccI CCATC 2 cut(s) 282, 347
BceAI ACGGC 1 cut(s) 24
BcoDI GTCTC 2 cut(s) 126, 237
BfaI CTAG 1 cut(s) 423
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 4 cut(s) 6, 9, 330, 346
BlsI GCNGC 4 cut(s) 7, 10, 331, 347
Bme18I GGWCC 2 cut(s) 153, 434
BmgT120I GGNCC 5 cut(s) 37, 153, 271, 406, 434
BmsI GCATC 2 cut(s) 98, 266
Bse1I ACTGG 1 cut(s) 396
BseGI GGATG 1 cut(s) 274
BseMII CTCAG 2 cut(s) 137, 192
BseNI ACTGG 1 cut(s) 396
BseXI GCAGC 2 cut(s) 20, 316
BshFI GGCC 4 cut(s) 39, 272, 345, 408
BslFI GGGAC 2 cut(s) 425, 433
BsmAI GTCTC 2 cut(s) 126, 237
BsmFI GGGAC 2 cut(s) 425, 433
BsnI GGCC 4 cut(s) 39, 272, 345, 408
BspACI CCGC 1 cut(s) 346
BspANI GGCC 4 cut(s) 39, 272, 345, 408
BspCNI CTCAG 2 cut(s) 136, 191
BspMAI CTGCAG 1 cut(s) 10
BsrI ACTGG 1 cut(s) 396
BssSI CACGAG 2 cut(s) 30, 446
Bst2BI CACGAG 2 cut(s) 30, 446
BstC8I GCNNGC 1 cut(s) 410
BstDEI CTNAG 3 cut(s) 123, 178, 479
BstF5I GGATG 1 cut(s) 274
BstHHI GCGC 1 cut(s) 89
BstMAI GTCTC 2 cut(s) 126, 237
BstMWI GCNNNNNNNGC 4 cut(s) 14, 84, 215, 409
BstNSI RCATGY 2 cut(s) 108, 470
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 2 cut(s) 20, 316
BstXI CCANNNNNNTGG 2 cut(s) 281, 416
BsuRI GGCC 4 cut(s) 39, 272, 345, 408
BtsCI GGATG 1 cut(s) 274
Cac8I GCNNGC 1 cut(s) 410
CfoI GCGC 1 cut(s) 89
Cfr13I GGNCC 5 cut(s) 37, 153, 271, 406, 434
Csp6I GTAC 1 cut(s) 389
CspCI CAANNNNNGTGG 2 cut(s) 432, 467
CviAII CATG 4 cut(s) 95, 105, 334, 467
CviQI GTAC 1 cut(s) 389
DdeI CTNAG 3 cut(s) 123, 178, 479
DrdI GACNNNNNNGTC 1 cut(s) 383
DseDI GACNNNNNNGTC 1 cut(s) 383
Eco47I GGWCC 2 cut(s) 153, 434
FaeI CATG 4 cut(s) 98, 108, 337, 470
FaiI YATR 8 cut(s) 96, 106, 143, 203, 312, 335, 468, 495
FaqI GGGAC 2 cut(s) 425, 433
FatI CATG 4 cut(s) 94, 104, 333, 466
Fnu4HI GCNGC 4 cut(s) 6, 9, 330, 346
FokI GGATG 1 cut(s) 261
Fsp4HI GCNGC 4 cut(s) 6, 9, 330, 346
FspBI CTAG 1 cut(s) 423
GlaI GCGC 1 cut(s) 88
GluI GCNGC 4 cut(s) 6, 9, 330, 346
HaeIII GGCC 4 cut(s) 39, 272, 345, 408
HhaI GCGC 1 cut(s) 89
Hin1II CATG 4 cut(s) 98, 108, 337, 470
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HincII GTYRAC 1 cut(s) 397
HindII GTYRAC 1 cut(s) 397
HindIII AAGCTT 1 cut(s) 207
HinfI GANTC 1 cut(s) 475
HphI GGTGA 1 cut(s) 205
Hpy166II GTNNAC 2 cut(s) 172, 397
Hpy8I GTNNAC 2 cut(s) 172, 397
HpyAV CCTTC 2 cut(s) 184, 208
HpyCH4V TGCA 5 cut(s) 8, 108, 201, 257, 337
HpyF10VI GCNNNNNNNGC 4 cut(s) 14, 84, 215, 409
HpyF3I CTNAG 3 cut(s) 123, 178, 479
Hsp92II CATG 4 cut(s) 98, 108, 337, 470
HspAI GCGC 1 cut(s) 87
LpnPI CCDG 6 cut(s) 60, 165, 377, 389, 422, 450
Lsp1109I GCAGC 2 cut(s) 20, 316
LweI GCATC 2 cut(s) 98, 266
MaeI CTAG 1 cut(s) 423
MboII GAAGA 2 cut(s) 199, 304
MfeI CAATTG 2 cut(s) 249, 414
MluCI AATT 2 cut(s) 249, 414
MnlI CCTC 4 cut(s) 144, 262, 335, 355
MseI TTAA 1 cut(s) 471
MslI CAYNNNNRTG 2 cut(s) 146, 279
MspA1I CMGCKG 1 cut(s) 348
MunI CAATTG 2 cut(s) 249, 414
MwoI GCNNNNNNNGC 4 cut(s) 14, 84, 215, 409
NlaIII CATG 4 cut(s) 98, 108, 337, 470
NspI RCATGY 2 cut(s) 108, 470
PcsI WCGNNNNNNNCGW 1 cut(s) 37
PfeI GAWTC 1 cut(s) 475
PkrI GCNGC 4 cut(s) 7, 10, 331, 347
PspPI GGNCC 5 cut(s) 37, 153, 271, 406, 434
PstI CTGCAG 1 cut(s) 10
RsaI GTAC 1 cut(s) 390
RsaNI GTAC 1 cut(s) 389
RseI CAYNNNNRTG 2 cut(s) 146, 279
SaqAI TTAA 1 cut(s) 471
SatI GCNGC 4 cut(s) 6, 9, 330, 346
Sau96I GGNCC 5 cut(s) 37, 153, 271, 406, 434
SetI ASST 6 cut(s) 13, 195, 211, 306, 366, 439
SfaNI GCATC 2 cut(s) 98, 266
SfcI CTRYAG 1 cut(s) 6
SinI GGWCC 2 cut(s) 153, 434
SmiMI CAYNNNNRTG 2 cut(s) 146, 279
Sse9I AATT 2 cut(s) 249, 414
SsiI CCGC 1 cut(s) 346
SspMI CTAG 1 cut(s) 423
TasI AATT 2 cut(s) 249, 414
TauI GCSGC 1 cut(s) 348
TfiI GAWTC 1 cut(s) 475
Tru1I TTAA 1 cut(s) 471
Tru9I TTAA 1 cut(s) 471
TseI GCWGC 3 cut(s) 5, 8, 329
TspDTI ATGAA 1 cut(s) 130
VpaK11BI GGWCC 2 cut(s) 153, 434
XceI RCATGY 2 cut(s) 108, 470
XspI CTAG 1 cut(s) 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.