Rmu_sc0000523.1_g000004

Nuclear transport factor 2 (NTF2) family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000523.1
Physical Location & Seq
Reverse (-)
55828 .. 58804
2977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000523.1_g000004.1.cds

Sequence Viewer

Length: 480 bp
atgtcccagcacaggttacctaacaagtttgtattgaatcattccagatatgggtctcgtgcaacaccttccgactttgaaatttatgctccaaatgcttcatttgaggacccactgatgcgtgctcaagggttgaagcagatcaagtcagcattttattcactatccaaggttttcagtgaatcaagaattgtggaatacaacatccaagaaaatatgctttctcccgaaaatcatgagatattgatcgataacaaacaatactacaaattctttggaagagacataaatgtgacgtcactcatcaagttgtatgccttggaaggaaaaattgttcgtcacgaagattggtgggagaagaagcctcttttgaacagagaaacagttaaattaccactgatgggccgaattatggaactgagtcgtagaggttcaatgctggcaactcatgttatgatggggtttgggaaggacccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

18.6

Weight (kDa)

9.42

Isoelectric Point (pI)

46.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015419)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G04830 AT5G04830
malus_domestica MD07G1062000.v1.1
prunus_persica Prupe.2G071800_v2.0.a1
pyrus_communis pycom07g04740
rosa_chinensis RchiOBHm_Chr1g0331851
rosa_laevigata RLG00000029708
rosa_multiflora Rmu_sc0000523.1_g000004
rosa_roxburghii Rroxscaffold_4G00318630
rosa_rugosa Rorug01G0096800 Rorug01G0096800
rosa_samantha Rh1AG120900 Rh1BG092400 Rh1CG115700 Rh1DG126800
rosa_wichuraiana Rw1G009830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 299
AcsI RAATTY 2 cut(s) 81, 269
AcyI GRCGYC 1 cut(s) 296
AfiI CCNNNNNNNGG 4 cut(s) 12, 51, 401, 412
AgsI TTSAA 5 cut(s) 37, 80, 136, 373, 435
AloI GAACNNNNNNTCC 2 cut(s) 318, 350
Alw21I GWGCWC 1 cut(s) 127
Alw26I GTCTC 2 cut(s) 60, 276
AoxI GGCC 1 cut(s) 403
ApoI RAATTY 2 cut(s) 81, 269
AspS9I GGNCC 3 cut(s) 109, 403, 472
AvaII GGWCC 2 cut(s) 109, 472
BauI CACGAG 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 127
BccI CCATC 2 cut(s) 394, 451
BcoDI GTCTC 2 cut(s) 60, 276
Bme18I GGWCC 2 cut(s) 109, 472
BmgT120I GGNCC 3 cut(s) 109, 403, 472
BmiI GGNNCC 2 cut(s) 111, 474
BmsI GCATC 1 cut(s) 108
BpuEI CTTGAG 1 cut(s) 111
Bsa29I ATCGAT 1 cut(s) 249
BsaBI GATNNNNATC 1 cut(s) 245
BsaHI GRCGYC 1 cut(s) 296
BsaI GGTCTC 1 cut(s) 60
BsaJI CCNNGG 2 cut(s) 168, 318
Bsc4I CCNNNNNNNGG 4 cut(s) 12, 51, 401, 412
Bse8I GATNNNNATC 1 cut(s) 245
BseCI ATCGAT 1 cut(s) 249
BseDI CCNNGG 2 cut(s) 168, 318
BseGI GGATG 1 cut(s) 204
BseJI GATNNNNATC 1 cut(s) 245
BseLI CCNNNNNNNGG 4 cut(s) 12, 51, 401, 412
BseMII CTCAG 1 cut(s) 410
BseYI CCCAGC 1 cut(s) 6
BshFI GGCC 1 cut(s) 405
BshVI ATCGAT 1 cut(s) 249
BsiHKAI GWGCWC 1 cut(s) 127
BslI CCNNNNNNNGG 4 cut(s) 12, 51, 401, 412
BsmAI GTCTC 2 cut(s) 60, 276
BsnI GGCC 1 cut(s) 405
Bso31I GGTCTC 1 cut(s) 60
Bsp1286I GDGCHC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 141, 246
BspANI GGCC 1 cut(s) 405
BspCNI CTCAG 1 cut(s) 411
BspDI ATCGAT 1 cut(s) 249
BspHI TCATGA 1 cut(s) 235
BspLI GGNNCC 2 cut(s) 111, 474
BspTNI GGTCTC 1 cut(s) 60
BssECI CCNNGG 2 cut(s) 168, 318
BssMI GATC 2 cut(s) 141, 246
BssNI GRCGYC 1 cut(s) 296
BssSI CACGAG 1 cut(s) 57
BssT1I CCWWGG 2 cut(s) 168, 318
Bst2BI CACGAG 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 385
Bst6I CTCTTC 1 cut(s) 274
BstACI GRCGYC 1 cut(s) 296
BstC8I GCNNGC 2 cut(s) 123, 441
BstDEI CTNAG 1 cut(s) 419
BstEII GGTNACC 1 cut(s) 15
BstF5I GGATG 1 cut(s) 204
BstKTI GATC 2 cut(s) 144, 249
BstMAI GTCTC 2 cut(s) 60, 276
BstMBI GATC 2 cut(s) 141, 246
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 15
Bsu15I ATCGAT 1 cut(s) 249
BsuRI GGCC 1 cut(s) 405
BsuTUI ATCGAT 1 cut(s) 249
BtsCI GGATG 1 cut(s) 204
BtsIMutI CAGTG 3 cut(s) 113, 184, 395
Cac8I GCNNGC 2 cut(s) 123, 441
CciI TCATGA 1 cut(s) 235
Cfr13I GGNCC 3 cut(s) 109, 403, 472
ClaI ATCGAT 1 cut(s) 249
CspCI CAANNNNNGTGG 2 cut(s) 174, 209
CviAII CATG 2 cut(s) 236, 449
CviJI RGCY 2 cut(s) 364, 405
CviKI_1 RGCY 2 cut(s) 364, 405
DdeI CTNAG 1 cut(s) 419
DpnI GATC 2 cut(s) 143, 248
DpnII GATC 2 cut(s) 141, 246
Eam1104I CTCTTC 1 cut(s) 274
EarI CTCTTC 1 cut(s) 274
Eco130I CCWWGG 2 cut(s) 168, 318
Eco31I GGTCTC 1 cut(s) 60
Eco47I GGWCC 2 cut(s) 109, 472
Eco91I GGTNACC 1 cut(s) 15
EcoO109I RGGNCCY 2 cut(s) 109, 472
EcoO65I GGTNACC 1 cut(s) 15
EcoT14I CCWWGG 2 cut(s) 168, 318
ErhI CCWWGG 2 cut(s) 168, 318
FaeI CATG 2 cut(s) 239, 452
FatI CATG 2 cut(s) 235, 448
FokI GGATG 1 cut(s) 191
GsaI CCCAGC 1 cut(s) 10
HaeIII GGCC 1 cut(s) 405
Hin1I GRCGYC 1 cut(s) 296
Hin1II CATG 2 cut(s) 239, 452
HinfI GANTC 3 cut(s) 37, 182, 421
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 5 cut(s) 45, 186, 227, 236, 341
HpyAV CCTTC 3 cut(s) 78, 317, 463
HpyCH4III ACNGT 1 cut(s) 385
HpyCH4IV ACGT 1 cut(s) 296
HpyCH4V TGCA 1 cut(s) 62
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 419
HpySE526I ACGT 1 cut(s) 296
Hsp92I GRCGYC 1 cut(s) 296
Hsp92II CATG 2 cut(s) 239, 452
Kzo9I GATC 2 cut(s) 141, 246
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 3 cut(s) 20, 58, 425
LweI GCATC 1 cut(s) 108
MaeII ACGT 1 cut(s) 296
MaeIII GTNAC 4 cut(s) 15, 292, 297, 338
MalI GATC 2 cut(s) 143, 248
MboI GATC 2 cut(s) 141, 246
MboII GAAGA 3 cut(s) 291, 356, 370
MhlI GDGCHC 1 cut(s) 127
MluCI AATT 6 cut(s) 81, 189, 269, 330, 389, 408
MlyI GAGTC 1 cut(s) 430
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 3 cut(s) 100, 375, 422
MseI TTAA 1 cut(s) 387
MslI CAYNNNNRTG 1 cut(s) 290
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 2 cut(s) 141, 246
NlaIII CATG 2 cut(s) 239, 452
NlaIV GGNNCC 2 cut(s) 111, 474
NmuCI GTSAC 3 cut(s) 292, 297, 338
PagI TCATGA 1 cut(s) 235
PfeI GAWTC 2 cut(s) 37, 182
PleI GAGTC 1 cut(s) 429
PpsI GAGTC 1 cut(s) 429
PpuMI RGGWCCY 2 cut(s) 109, 472
Psp5II RGGWCCY 2 cut(s) 109, 472
PspEI GGTNACC 1 cut(s) 15
PspFI CCCAGC 1 cut(s) 6
PspN4I GGNNCC 2 cut(s) 111, 474
PspPI GGNCC 3 cut(s) 109, 403, 472
PspPPI RGGWCCY 2 cut(s) 109, 472
RseI CAYNNNNRTG 1 cut(s) 290
SaqAI TTAA 1 cut(s) 387
Sau3AI GATC 2 cut(s) 141, 246
Sau96I GGNCC 3 cut(s) 109, 403, 472
SchI GAGTC 1 cut(s) 430
SduI GDGCHC 1 cut(s) 127
SetI ASST 6 cut(s) 17, 22, 70, 174, 299, 433
SfaNI GCATC 1 cut(s) 108
SinI GGWCC 2 cut(s) 109, 472
SmiMI CAYNNNNRTG 1 cut(s) 290
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
Sse9I AATT 6 cut(s) 81, 189, 269, 330, 389, 408
StyI CCWWGG 2 cut(s) 168, 318
TaaI ACNGT 1 cut(s) 385
TaiI ACGT 1 cut(s) 299
TaqI TCGA 1 cut(s) 249
TasI AATT 6 cut(s) 81, 189, 269, 330, 389, 408
TfiI GAWTC 2 cut(s) 37, 182
Tru1I TTAA 1 cut(s) 387
Tru9I TTAA 1 cut(s) 387
TscAI CASTG 3 cut(s) 120, 184, 402
TseFI GTSAC 3 cut(s) 292, 297, 338
Tsp45I GTSAC 3 cut(s) 292, 297, 338
TspDTI ATGAA 1 cut(s) 90
TspRI CASTG 3 cut(s) 120, 184, 402
VpaK11BI GGWCC 2 cut(s) 109, 472
XapI RAATTY 2 cut(s) 81, 269
ZraI GACGTC 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.