Rmu_sc0000575.1_g000021

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000575.1
Physical Location & Seq
Reverse (-)
146503 .. 146941
439 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000575.1_g000021.1.cds

Sequence Viewer

Length: 360 bp
atgtttgtggcaggaaaaagcgccatctttaaccagctatccccctatctggttgtgaagaaaaatggcagagaattcggaaccatattagctaaaaggagagatttgccacctgaaaatccaagtactcaaggaggaaaattcgtcttccccccattgagggtttcgaatacaattcttgctaggtctgtggtggctgtgttgggattaggattcatcgatgcagggtatagtggagactggtcaaggattggagtgatctcaaaagagattgaggacttgctaaaggttgctgcatttctagttgttccattctgtttgttcctcatattttctatctccaaagaacaggaggattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.06

Weight (kDa)

9.2

Isoelectric Point (pI)

50.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012213)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 74, 140
AfaI GTAC 1 cut(s) 127
AfiI CCNNNNNNNGG 3 cut(s) 49, 159, 160
AluBI AGCT 2 cut(s) 37, 92
AluI AGCT 2 cut(s) 37, 92
Alw26I GTCTC 1 cut(s) 231
ApeKI GCWGC 1 cut(s) 293
ApoI RAATTY 2 cut(s) 74, 140
AspLEI GCGC 1 cut(s) 23
AsuII TTCGAA 1 cut(s) 167
BbsI GAAGAC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 280
BccI CCATC 1 cut(s) 32
BcgI CGANNNNNNTGC 2 cut(s) 58, 92
BcoDI GTCTC 1 cut(s) 231
BfaI CTAG 2 cut(s) 183, 302
BfoI RGCGCY 1 cut(s) 24
BisI GCNGC 1 cut(s) 294
BlsI GCNGC 1 cut(s) 295
BmcAI AGTACT 1 cut(s) 127
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 1 cut(s) 211
BpiI GAAGAC 1 cut(s) 139
Bpu14I TTCGAA 1 cut(s) 167
BpuEI CTTGAG 1 cut(s) 114
Bsa29I ATCGAT 1 cut(s) 219
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 159, 160
Bse1I ACTGG 1 cut(s) 245
BseCI ATCGAT 1 cut(s) 219
BseLI CCNNNNNNNGG 3 cut(s) 49, 159, 160
BseNI ACTGG 1 cut(s) 245
BseXI GCAGC 1 cut(s) 280
BshVI ATCGAT 1 cut(s) 219
BslI CCNNNNNNNGG 3 cut(s) 49, 159, 160
BsmAI GTCTC 1 cut(s) 231
Bsp119I TTCGAA 1 cut(s) 167
Bsp143I GATC 1 cut(s) 258
BspDI ATCGAT 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 82
BspT104I TTCGAA 1 cut(s) 167
BsrI ACTGG 1 cut(s) 245
BssMI GATC 1 cut(s) 258
BstBI TTCGAA 1 cut(s) 167
BstH2I RGCGCY 1 cut(s) 24
BstHHI GCGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 261
BstMAI GTCTC 1 cut(s) 231
BstMBI GATC 1 cut(s) 258
BstV1I GCAGC 1 cut(s) 280
BstV2I GAAGAC 1 cut(s) 139
Bsu15I ATCGAT 1 cut(s) 219
BsuTUI ATCGAT 1 cut(s) 219
CfoI GCGC 1 cut(s) 23
ClaI ATCGAT 1 cut(s) 219
Csp6I GTAC 1 cut(s) 126
CviJI RGCY 3 cut(s) 37, 92, 197
CviKI_1 RGCY 3 cut(s) 37, 92, 197
CviQI GTAC 1 cut(s) 126
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
EcoRI GAATTC 1 cut(s) 74
FaiI YATR 3 cut(s) 86, 231, 329
Fnu4HI GCNGC 1 cut(s) 294
Fsp4HI GCNGC 1 cut(s) 294
FspBI CTAG 2 cut(s) 183, 302
GlaI GCGC 1 cut(s) 22
GluI GCNGC 1 cut(s) 294
HaeII RGCGCY 1 cut(s) 24
HhaI GCGC 1 cut(s) 23
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HinfI GANTC 1 cut(s) 213
Hpy188I TCNGA 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 224, 296
HspAI GCGC 1 cut(s) 21
Kzo9I GATC 1 cut(s) 258
LpnPI CCDG 6 cut(s) 35, 47, 126, 210, 226, 335
Lsp1109I GCAGC 1 cut(s) 280
LweI GCATC 1 cut(s) 211
MaeI CTAG 2 cut(s) 183, 302
MalI GATC 1 cut(s) 260
MboI GATC 1 cut(s) 258
MboII GAAGA 2 cut(s) 70, 139
MluCI AATT 3 cut(s) 74, 140, 174
MnlI CCTC 5 cut(s) 128, 153, 268, 335, 346
MseI TTAA 1 cut(s) 30
NdeII GATC 1 cut(s) 258
NlaIV GGNNCC 1 cut(s) 82
NspV TTCGAA 1 cut(s) 167
PfeI GAWTC 1 cut(s) 213
PkrI GCNGC 1 cut(s) 295
PspN4I GGNNCC 1 cut(s) 82
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 1 cut(s) 294
Sau3AI GATC 1 cut(s) 258
ScaI AGTACT 1 cut(s) 127
SetI ASST 5 cut(s) 39, 94, 115, 188, 291
SfaNI GCATC 1 cut(s) 211
SfuI TTCGAA 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 3 cut(s) 74, 140, 174
SspMI CTAG 2 cut(s) 183, 302
TaqI TCGA 2 cut(s) 167, 219
TasI AATT 3 cut(s) 74, 140, 174
TatI WGTACW 1 cut(s) 125
TfiI GAWTC 1 cut(s) 213
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TseI GCWGC 1 cut(s) 293
TspDTI ATGAA 1 cut(s) 205
XapI RAATTY 2 cut(s) 74, 140
XspI CTAG 2 cut(s) 183, 302
ZrmI AGTACT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.