Rmu_sc0000704.1_g000040

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000704.1
OG0017775
Physical Location & Seq
Forward (+)
154277 .. 154501
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000704.1_g000040.1.cds

Sequence Viewer

Length: 225 bp
atggtagcggcaaaattggccaaagctgatagagcaaaagacaaggctttgcagcagaatgatgagattaagaatcaattgaatgacttcgttctggagaaggatgggttcaaggctgagattgggaattccacgcatatgctcatgtctgggattgttaagatttcaggtaaagttagtaattttaagaatttggctatccggggattgccagaggtcgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.13

Weight (kDa)

9.05

Isoelectric Point (pI)

10.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 8
AcoI YGGCCR 1 cut(s) 18
AcsI RAATTY 2 cut(s) 127, 190
AgsI TTSAA 2 cut(s) 82, 112
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AoxI GGCC 1 cut(s) 18
ApeKI GCWGC 1 cut(s) 52
ApoI RAATTY 2 cut(s) 127, 190
Asp700I GAANNNNTTC 1 cut(s) 86
AsuC2I CCSGG 1 cut(s) 203
BalI TGGCCA 1 cut(s) 20
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 98
BcnI CCSGG 1 cut(s) 203
BisI GCNGC 2 cut(s) 9, 53
BlsI GCNGC 2 cut(s) 10, 54
Bme1390I CCNGG 1 cut(s) 203
BmrFI CCNGG 1 cut(s) 203
BpmI CTGGAG 1 cut(s) 116
BpuMI CCSGG 1 cut(s) 203
BsaJI CCNNGG 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 202
BseGI GGATG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 108
BseXI GCAGC 1 cut(s) 64
BshFI GGCC 1 cut(s) 20
BsiSI CCGG 1 cut(s) 202
BsnI GGCC 1 cut(s) 20
BspACI CCGC 1 cut(s) 8
BspANI GGCC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 202
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 109
BstMWI GCNNNNNNNGC 2 cut(s) 17, 32
BstSCI CCNGG 1 cut(s) 201
BstV1I GCAGC 1 cut(s) 64
BsuRI GGCC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 109
CviAII CATG 1 cut(s) 145
CviJI RGCY 5 cut(s) 20, 26, 47, 116, 197
CviKI_1 RGCY 5 cut(s) 20, 26, 47, 116, 197
DdeI CTNAG 1 cut(s) 117
EaeI YGGCCR 1 cut(s) 18
EcoRI GAATTC 1 cut(s) 127
FaeI CATG 1 cut(s) 148
FaiI YATR 3 cut(s) 138, 140, 146
FatI CATG 1 cut(s) 144
FauNDI CATATG 1 cut(s) 138
Fnu4HI GCNGC 2 cut(s) 9, 53
FokI GGATG 1 cut(s) 116
Fsp4HI GCNGC 2 cut(s) 9, 53
GluI GCNGC 2 cut(s) 9, 53
GsuI CTGGAG 1 cut(s) 116
HaeIII GGCC 1 cut(s) 20
HapII CCGG 1 cut(s) 202
Hin1II CATG 1 cut(s) 148
HinfI GANTC 1 cut(s) 73
HpaII CCGG 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 32
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 1 cut(s) 148
LpnPI CCDG 4 cut(s) 80, 135, 153, 215
Lsp1109I GCAGC 1 cut(s) 64
MfeI CAATTG 1 cut(s) 77
MlsI TGGCCA 1 cut(s) 20
MluCI AATT 5 cut(s) 14, 77, 127, 181, 190
MluNI TGGCCA 1 cut(s) 20
MnlI CCTC 1 cut(s) 208
Mox20I TGGCCA 1 cut(s) 20
MroXI GAANNNNTTC 1 cut(s) 86
MscI TGGCCA 1 cut(s) 20
MseI TTAA 3 cut(s) 69, 159, 186
MslI CAYNNNNRTG 1 cut(s) 137
Msp20I TGGCCA 1 cut(s) 20
MspI CCGG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 203
MunI CAATTG 1 cut(s) 77
MwoI GCNNNNNNNGC 2 cut(s) 17, 32
NciI CCSGG 1 cut(s) 203
NdeI CATATG 1 cut(s) 138
NlaIII CATG 1 cut(s) 148
PdmI GAANNNNTTC 1 cut(s) 86
PfeI GAWTC 1 cut(s) 73
PkrI GCNGC 2 cut(s) 10, 54
RseI CAYNNNNRTG 1 cut(s) 137
SaqAI TTAA 3 cut(s) 69, 159, 186
SatI GCNGC 2 cut(s) 9, 53
ScrFI CCNGG 1 cut(s) 203
SetI ASST 3 cut(s) 28, 172, 219
SgeI CNNG 9 cut(s) 55, 107, 124, 145, 157, 162, 180, 214, 215
SmiMI CAYNNNNRTG 1 cut(s) 137
Sse9I AATT 5 cut(s) 14, 77, 127, 181, 190
SsiI CCGC 1 cut(s) 8
StyD4I CCNGG 1 cut(s) 201
TaqI TCGA 1 cut(s) 219
TasI AATT 5 cut(s) 14, 77, 127, 181, 190
TauI GCSGC 1 cut(s) 11
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 3 cut(s) 69, 159, 186
Tru9I TTAA 3 cut(s) 69, 159, 186
TseI GCWGC 1 cut(s) 52
XapI RAATTY 2 cut(s) 127, 190
XmnI GAANNNNTTC 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.