Rmu_sc0000912.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000912.1
Physical Location & Seq
Reverse (-)
39422 .. 40202
781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000912.1_g000005.1.cds

Sequence Viewer

Length: 306 bp
atgcactcggtcaatgctgttttactccttggggatgcaatgttaaattgcttgcaagttccctttgttcggatatctttgtttgttttatggactggtgctttcgtcattttccagtggatcattcatgcttgtgtatcaatatggtggccatacccattccttgacttgtcatcaccatatgccccagtttggtacttaatggtgggattgatgcatatcccatgctatgctttattcgcactaatcgttgggtcaaagcgtcacctattgtcaaaatggtttcctctgtcatgtcaatgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.62

Weight (kDa)

8.36

Isoelectric Point (pI)

60.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 128
AcoI YGGCCR 1 cut(s) 149
AfaI GTAC 1 cut(s) 197
AfiI CCNNNNNNNGG 2 cut(s) 69, 192
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 149
AsuHPI GGTGA 2 cut(s) 168, 257
BalI TGGCCA 1 cut(s) 151
BmrI ACTGGG 1 cut(s) 182
BmsI GCATC 2 cut(s) 25, 204
BmuI ACTGGG 1 cut(s) 182
BsaBI GATNNNNATC 1 cut(s) 218
BsaJI CCNNGG 1 cut(s) 28
Bsc4I CCNNNNNNNGG 2 cut(s) 69, 192
Bse1I ACTGG 3 cut(s) 100, 115, 188
Bse3DI GCAATG 1 cut(s) 45
Bse8I GATNNNNATC 1 cut(s) 218
BseDI CCNNGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 40
BseJI GATNNNNATC 1 cut(s) 218
BseLI CCNNNNNNNGG 2 cut(s) 69, 192
BseMI GCAATG 1 cut(s) 45
BseNI ACTGG 3 cut(s) 100, 115, 188
BshFI GGCC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 69, 192
BsnI GGCC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 120
BspANI GGCC 1 cut(s) 151
BspPI GGATC 1 cut(s) 128
BsrDI GCAATG 1 cut(s) 45
BsrI ACTGG 3 cut(s) 100, 115, 188
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 120
BssT1I CCWWGG 1 cut(s) 28
BstC8I GCNNGC 1 cut(s) 53
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 123
BstMBI GATC 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 239
BsuRI GGCC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 122
Cac8I GCNNGC 1 cut(s) 53
CseI GACGC 1 cut(s) 251
Csp6I GTAC 1 cut(s) 196
CviAII CATG 3 cut(s) 128, 225, 294
CviJI RGCY 1 cut(s) 151
CviKI_1 RGCY 1 cut(s) 151
CviQI GTAC 1 cut(s) 196
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
EaeI YGGCCR 1 cut(s) 149
Eco130I CCWWGG 1 cut(s) 28
Eco32I GATATC 1 cut(s) 75
EcoRV GATATC 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 28
EcoT22I ATGCAT 1 cut(s) 219
ErhI CCWWGG 1 cut(s) 28
FaeI CATG 3 cut(s) 131, 228, 297
FatI CATG 3 cut(s) 127, 224, 293
FauNDI CATATG 1 cut(s) 181
FokI GGATG 1 cut(s) 47
HaeIII GGCC 1 cut(s) 151
HgaI GACGC 1 cut(s) 251
Hin1II CATG 3 cut(s) 131, 228, 297
HphI GGTGA 2 cut(s) 168, 257
Hpy188I TCNGA 1 cut(s) 72
HpyCH4V TGCA 4 cut(s) 4, 38, 55, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
Hsp92II CATG 3 cut(s) 131, 228, 297
Kzo9I GATC 1 cut(s) 120
LpnPI CCDG 3 cut(s) 81, 128, 201
LweI GCATC 2 cut(s) 25, 204
MaeIII GTNAC 1 cut(s) 263
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MlsI TGGCCA 1 cut(s) 151
MluCI AATT 1 cut(s) 46
MluNI TGGCCA 1 cut(s) 151
MnlI CCTC 1 cut(s) 297
Mox20I TGGCCA 1 cut(s) 151
Mph1103I ATGCAT 1 cut(s) 219
MscI TGGCCA 1 cut(s) 151
MseI TTAA 3 cut(s) 44, 200, 304
MslI CAYNNNNRTG 2 cut(s) 132, 298
Msp20I TGGCCA 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 239
NdeI CATATG 1 cut(s) 181
NdeII GATC 1 cut(s) 120
NlaIII CATG 3 cut(s) 131, 228, 297
NmuCI GTSAC 1 cut(s) 263
NsiI ATGCAT 1 cut(s) 219
PcsI WCGNNNNNNNCGW 1 cut(s) 246
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
RseI CAYNNNNRTG 2 cut(s) 132, 298
SaqAI TTAA 3 cut(s) 44, 200, 304
Sau3AI GATC 1 cut(s) 120
SetI ASST 1 cut(s) 270
SfaNI GCATC 2 cut(s) 25, 204
SmiMI CAYNNNNRTG 2 cut(s) 132, 298
Sse9I AATT 1 cut(s) 46
StyI CCWWGG 1 cut(s) 28
TasI AATT 1 cut(s) 46
Tru1I TTAA 3 cut(s) 44, 200, 304
Tru9I TTAA 3 cut(s) 44, 200, 304
TscAI CASTG 1 cut(s) 122
TseFI GTSAC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 263
TspDTI ATGAA 1 cut(s) 116
TspRI CASTG 1 cut(s) 122
Zsp2I ATGCAT 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.