Rmu_sc0000928.1_g000029

ENTH domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000928.1
Physical Location & Seq
Forward (+)
136685 .. 137311
627 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000928.1_g000029.1.cds

Sequence Viewer

Length: 627 bp
atgcaaaagaaatcggaccaaatactaatccttctaagaggggggccgacgctgagagaagcacgtttcaaagctctcaaattaacaaatgaaatccaaggctttagaggttcagtgtcttctccttcaccctcaactccttcctctgcctactctgaaacaccaagagcttcatcctttagttcattttctaccacaagttctgtatggaatgaattgaacaatgagcttagcaaatttcatcaaccatcgacaactaaatcagaagccatggaaagctattcacagggtggactgcgagacactgatgatgatcatgatcattacaagaatactagcaatttccccgcaccaagtgagagtagggaaggatcacacctttggaattgccctccaattgatgaaaaaggttcattacttgaattcgaagaagaagacgatgaggatgatgacaaatattatgagaaggaggatggtattttaagtggaatttactctaagctggttaaccttagtcctacaagaggaaatggacctcatggtaatattaggtttaggagtgtttctgatgtggggagggagctgaggaagaaaaagcttgatcgccaatcttcgttttggtactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

208

Amino Acids

23.47

Weight (kDa)

5.46

Isoelectric Point (pI)

53.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013320)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 348
AclWI GGATC 1 cut(s) 379
AcsI RAATTY 3 cut(s) 236, 422, 489
AdeI CACNNNGTG 2 cut(s) 290, 356
AfaI GTAC 1 cut(s) 623
AfiI CCNNNNNNNGG 1 cut(s) 524
AgsI TTSAA 3 cut(s) 70, 220, 422
AluBI AGCT 7 cut(s) 74, 170, 229, 279, 502, 583, 598
AluI AGCT 7 cut(s) 74, 170, 229, 279, 502, 583, 598
Alw26I GTCTC 1 cut(s) 294
AlwI GGATC 1 cut(s) 379
AoxI GGCC 1 cut(s) 44
ApoI RAATTY 3 cut(s) 236, 422, 489
AspS9I GGNCC 3 cut(s) 16, 44, 533
AsuHPI GGTGA 1 cut(s) 120
AsuII TTCGAA 1 cut(s) 426
AvaII GGWCC 2 cut(s) 16, 533
BbsI GAAGAC 2 cut(s) 111, 441
BbvCI CCTCAGC 1 cut(s) 584
BccI CCATC 2 cut(s) 256, 467
BclI TGATCA 2 cut(s) 313, 319
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 1 cut(s) 336
BlpI GCTNAGC 1 cut(s) 230
Bme18I GGWCC 2 cut(s) 16, 533
BmgT120I GGNCC 3 cut(s) 16, 44, 533
BmiI GGNNCC 1 cut(s) 45
BpiI GAAGAC 2 cut(s) 111, 441
Bpu10I CCTNAGC 1 cut(s) 584
Bpu1102I GCTNAGC 1 cut(s) 230
Bpu14I TTCGAA 1 cut(s) 426
BsaBI GATNNNNATC 2 cut(s) 312, 318
BsaJI CCNNGG 2 cut(s) 97, 270
Bsc4I CCNNNNNNNGG 1 cut(s) 524
Bse8I GATNNNNATC 2 cut(s) 312, 318
BseDI CCNNGG 2 cut(s) 97, 270
BseGI GGATG 3 cut(s) 173, 451, 478
BseJI GATNNNNATC 2 cut(s) 312, 318
BseLI CCNNNNNNNGG 1 cut(s) 524
BseMII CTCAG 2 cut(s) 44, 575
BshFI GGCC 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 524
BsmAI GTCTC 1 cut(s) 294
BsnI GGCC 1 cut(s) 46
Bsp119I TTCGAA 1 cut(s) 426
Bsp143I GATC 4 cut(s) 313, 319, 371, 601
Bsp1720I GCTNAGC 1 cut(s) 230
Bsp19I CCATGG 1 cut(s) 270
BspACI CCGC 1 cut(s) 348
BspANI GGCC 1 cut(s) 46
BspCNI CTCAG 2 cut(s) 45, 576
BspHI TCATGA 1 cut(s) 316
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 1 cut(s) 379
BspT104I TTCGAA 1 cut(s) 426
BssECI CCNNGG 2 cut(s) 97, 270
BssMI GATC 4 cut(s) 313, 319, 371, 601
BssT1I CCWWGG 2 cut(s) 97, 270
BstBI TTCGAA 1 cut(s) 426
BstDEI CTNAG 6 cut(s) 35, 53, 230, 498, 512, 584
BstDSI CCRYGG 1 cut(s) 270
BstENI CCTNNNNNAGG 1 cut(s) 522
BstF5I GGATG 3 cut(s) 173, 451, 478
BstKTI GATC 4 cut(s) 316, 322, 374, 604
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 4 cut(s) 313, 319, 371, 601
BstV2I GAAGAC 2 cut(s) 111, 441
BsuRI GGCC 1 cut(s) 46
BtgI CCRYGG 1 cut(s) 270
BtsCI GGATG 3 cut(s) 173, 451, 478
BtsIMutI CAGTG 2 cut(s) 120, 303
CciI TCATGA 1 cut(s) 316
Cfr13I GGNCC 3 cut(s) 16, 44, 533
CseI GACGC 1 cut(s) 58
Csp6I GTAC 1 cut(s) 622
CviAII CATG 3 cut(s) 271, 317, 539
CviQI GTAC 1 cut(s) 622
DdeI CTNAG 6 cut(s) 35, 53, 230, 498, 512, 584
DpnI GATC 4 cut(s) 315, 321, 373, 603
DpnII GATC 4 cut(s) 313, 319, 371, 601
DraIII CACNNNGTG 2 cut(s) 290, 356
Eco130I CCWWGG 2 cut(s) 97, 270
Eco47I GGWCC 2 cut(s) 16, 533
EcoNI CCTNNNNNAGG 1 cut(s) 522
EcoRI GAATTC 1 cut(s) 422
EcoT14I CCWWGG 2 cut(s) 97, 270
ErhI CCWWGG 2 cut(s) 97, 270
FaeI CATG 3 cut(s) 274, 320, 542
FaiI YATR 5 cut(s) 208, 272, 318, 462, 540
FatI CATG 3 cut(s) 270, 316, 538
FauI CCCGC 1 cut(s) 355
FbaI TGATCA 2 cut(s) 313, 319
FokI GGATG 3 cut(s) 160, 458, 485
FspBI CTAG 1 cut(s) 336
HaeIII GGCC 1 cut(s) 46
HgaI GACGC 1 cut(s) 58
Hin1II CATG 3 cut(s) 274, 320, 542
HincII GTYRAC 1 cut(s) 508
HindII GTYRAC 1 cut(s) 508
HindIII AAGCTT 1 cut(s) 596
HpaI GTTAAC 1 cut(s) 508
HphI GGTGA 1 cut(s) 120
Hpy166II GTNNAC 2 cut(s) 293, 508
Hpy188I TCNGA 4 cut(s) 16, 157, 265, 568
Hpy188III TCNNGA 1 cut(s) 317
Hpy8I GTNNAC 2 cut(s) 293, 508
Hpy99I CGWCG 1 cut(s) 52
HpyAV CCTTC 5 cut(s) 41, 135, 150, 362, 460
HpyCH4IV ACGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 6 cut(s) 35, 53, 230, 498, 512, 584
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 3 cut(s) 274, 320, 542
Ksp22I TGATCA 2 cut(s) 313, 319
KspAI GTTAAC 1 cut(s) 508
Kzo9I GATC 4 cut(s) 313, 319, 371, 601
LmnI GCTCC 1 cut(s) 580
LpnPI CCDG 2 cut(s) 272, 488
MaeI CTAG 1 cut(s) 336
MaeII ACGT 1 cut(s) 64
MalI GATC 4 cut(s) 315, 321, 373, 603
MboI GATC 4 cut(s) 313, 319, 371, 601
MboII GAAGA 6 cut(s) 111, 440, 443, 446, 601, 603
MfeI CAATTG 1 cut(s) 396
MluCI AATT 8 cut(s) 80, 215, 236, 340, 385, 396, 422, 489
MseI TTAA 3 cut(s) 83, 482, 507
MunI CAATTG 1 cut(s) 396
NcoI CCATGG 1 cut(s) 270
NdeII GATC 4 cut(s) 313, 319, 371, 601
NlaIII CATG 3 cut(s) 274, 320, 542
NlaIV GGNNCC 1 cut(s) 45
NspV TTCGAA 1 cut(s) 426
PagI TCATGA 1 cut(s) 316
PspN4I GGNNCC 1 cut(s) 45
PspPI GGNCC 3 cut(s) 16, 44, 533
RsaI GTAC 1 cut(s) 623
RsaNI GTAC 1 cut(s) 622
SaqAI TTAA 3 cut(s) 83, 482, 507
Sau3AI GATC 4 cut(s) 313, 319, 371, 601
Sau96I GGNCC 3 cut(s) 16, 44, 533
SfuI TTCGAA 1 cut(s) 426
SinI GGWCC 2 cut(s) 16, 533
Sse9I AATT 8 cut(s) 80, 215, 236, 340, 385, 396, 422, 489
SsiI CCGC 1 cut(s) 348
SspI AATATT 2 cut(s) 458, 547
SspMI CTAG 1 cut(s) 336
StyI CCWWGG 2 cut(s) 97, 270
TaiI ACGT 1 cut(s) 67
TaqI TCGA 2 cut(s) 251, 426
TasI AATT 8 cut(s) 80, 215, 236, 340, 385, 396, 422, 489
Tru1I TTAA 3 cut(s) 83, 482, 507
Tru9I TTAA 3 cut(s) 83, 482, 507
TscAI CASTG 2 cut(s) 120, 310
TspDTI ATGAA 7 cut(s) 105, 162, 174, 228, 230, 402, 417
TspRI CASTG 2 cut(s) 120, 310
VpaK11BI GGWCC 2 cut(s) 16, 533
XagI CCTNNNNNAGG 1 cut(s) 522
XapI RAATTY 3 cut(s) 236, 422, 489
XspI CTAG 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.