Rmu_sc0000988.1_g000008

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000988.1
OG0017728
Physical Location & Seq
Forward (+)
40729 .. 42174
1446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000988.1_g000008.1.cds

Sequence Viewer

Length: 1446 bp
atgcgcagcaacatatttcacaaggcacaaagggtcatgacccttttcaagcagtgcaccaccatgaaagaggtcaagcaactccatgcccatataacccacaccgggctcgatcaaaccctctgtgttctcggcaaggtcatctcattttgcgcggtttcggacctcggagacatggactatgcggtctctgtgttcagcagcattgaaagcccagatgggtttttatggaacaccatgattagagggtttgggaagactgataagcccgaaagggcgtttgagttttgtaagagaatgcaggagaaaggaaatgtagctgacaattttaccctctcgttcttgctcaaggtttctgggcaattgggatcggatatattggggaagcagatacattgtactactgtgaaatatgggtttgattctaatgtgtttgtgaggaacactctaatccatatgtatggtatgtttggggatgcaaaaactgctctccacctgttcgatgaaatgcctagcccagatttagtggcgtggaataccattattgatagtcatgtgaattgcggaaagtgcaacgaagcgctagatttgttcttgaggatgatggataggggtgtagatactgacgaggccactgtcgttgtgaccctctcggcatgttctacattgggtgctttagattttgggaggtgggtacattgtttggttgatcatacggatcttggcaacgttgtgacggtgtctaattcgttaattgacatgtatgcgaaatgcggagctgttgaagaagcgtatgatgcttttaataagatgaaggggaagaagaacatagtatcttggaacacgatgattctcgggcttgcgacgcatggtcatgcggacaaatctttggaactgttcttgaaaatgttggaggagaagcttgagagaccggatggtgttactttcttgggagttctgtgtgcttgtagtcatggagggatggttgatgaaggaagaagatattttgaaattatgagccaagactatcagattcaaccaacagtgaagcactacggatgcatggttgatatgttggggcgagctgggtttgtggaggaggcttataggttgataaggagcatgccggtgaagtgtaatgccattgtatggaggacattgttgtcggcatgtcaggtgcacggtgaggtcgagcttggagagaaggtcaggagtcatcttttggagttggcttcagatcatagcagcgattatgtgcttctggctaacatgtatgcaagtttaggccagtggaacgaagctatgagagtaagaaggtcaatgcagtacaggggagttgagaaacctgagcccggtaatagcttggttggcgcagatcttcatatgaagttgaaaatggactcaactgaagcctattctgaagatataaatgcagcagtttactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

481

Amino Acids

53.83

Weight (kDa)

5.98

Isoelectric Point (pI)

39.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017728)

Species Orthologous Gene IDs
malus_domestica MD06G1195900.v1.1
prunus_persica Prupe.5G195700_v2.0.a1
pyrus_communis pycom06g17310
rosa_chinensis RchiOBHm_Chr7g0181731
rosa_laevigata RLG00000005173
rosa_multiflora Rmu_sc0000988.1_g000008
rosa_roxburghii Rroxscaffold_3G00271770
rosa_rugosa Rorug06G0443000
rosa_samantha Rh7AG045600 Rh7BG044800 Rh7CG046300
rosa_wichuraiana Rw7G003800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 185, 1162
Acc16I TGCGCA 1 cut(s) 5
AccB7I CCANNNNNTGG 1 cut(s) 1149
AccII CGCG 1 cut(s) 155
AciI CCGC 5 cut(s) 155, 185, 564, 774, 878
AclI AACGTT 1 cut(s) 729
AclWI GGATC 2 cut(s) 376, 726
AcuI CTGAAG 3 cut(s) 1218, 1428, 1440
AfaI GTAC 3 cut(s) 400, 696, 1328
AfeI AGCGCT 1 cut(s) 582
AfiI CCNNNNNNNGG 3 cut(s) 105, 1149, 1352
AflIII ACRYGT 2 cut(s) 759, 1269
AgsI TTSAA 7 cut(s) 49, 209, 785, 904, 1010, 1037, 1393
AhdI GACNNNNNGTC 1 cut(s) 870
AluBI AGCT 7 cut(s) 320, 779, 922, 1085, 1195, 1301, 1362
AluI AGCT 7 cut(s) 320, 779, 922, 1085, 1195, 1301, 1362
Alw21I GWGCWC 2 cut(s) 59, 1182
Alw26I GTCTC 3 cut(s) 165, 193, 922
Alw44I GTGCAC 2 cut(s) 55, 1178
AlwI GGATC 2 cut(s) 376, 726
Ama87I CYCGRG 1 cut(s) 854
Aor51HI AGCGCT 1 cut(s) 582
AoxI GGCC 2 cut(s) 630, 1285
ApaLI GTGCAC 2 cut(s) 55, 1178
ApeKI GCWGC 4 cut(s) 6, 201, 1245, 1433
AspLEI GCGC 4 cut(s) 6, 155, 583, 1373
AspS9I GGNCC 1 cut(s) 163
AsuC2I CCSGG 2 cut(s) 106, 1353
AsuHPI GGTGA 2 cut(s) 1141, 1196
AvaI CYCGRG 1 cut(s) 854
AvaII GGWCC 1 cut(s) 163
BaeGI GKGCMC 2 cut(s) 59, 1182
BanII GRGCYC 2 cut(s) 111, 1353
BbsI GAAGAC 1 cut(s) 263
Bbv12I GWGCWC 2 cut(s) 59, 1182
BbvI GCAGC 3 cut(s) 18, 213, 1257
BccI CCATC 4 cut(s) 212, 598, 929, 976
BclI TGATCA 1 cut(s) 709
BcnI CCSGG 2 cut(s) 106, 1353
BcoDI GTCTC 3 cut(s) 165, 193, 922
BfaI CTAG 3 cut(s) 513, 584, 1444
BfoI RGCGCY 1 cut(s) 584
BglII AGATCT 1 cut(s) 1375
BisI GCNGC 4 cut(s) 7, 202, 1246, 1434
BlsI GCNGC 4 cut(s) 8, 203, 1247, 1435
Bme1390I CCNGG 2 cut(s) 106, 1353
Bme18I GGWCC 1 cut(s) 163
BmeRI GACNNNNNGTC 1 cut(s) 870
BmeT110I CYCGRG 1 cut(s) 854
BmgT120I GGNCC 1 cut(s) 163
BmrFI CCNGG 2 cut(s) 106, 1353
BmsI GCATC 3 cut(s) 466, 787, 1049
BpiI GAAGAC 1 cut(s) 263
BplI GAGNNNNNCTC 2 cut(s) 430, 462
Bpu10I CCTNAGC 1 cut(s) 1347
BpuEI CTTGAG 3 cut(s) 332, 616, 944
BpuMI CCSGG 2 cut(s) 106, 1353
BsaI GGTCTC 2 cut(s) 193, 922
BsaJI CCNNGG 1 cut(s) 166
BsaWI WCCGGW 1 cut(s) 931
BsaXI ACNNNNNCTCC 4 cut(s) 969, 999, 1191, 1221
Bsc4I CCNNNNNNNGG 3 cut(s) 105, 1149, 1352
Bse118I RCCGGY 1 cut(s) 1126
Bse1I ACTGG 1 cut(s) 1288
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 5 cut(s) 481, 606, 940, 987, 1064
BseLI CCNNNNNNNGG 3 cut(s) 105, 1149, 1352
BseMII CTCAG 1 cut(s) 1338
BseNI ACTGG 1 cut(s) 1288
BseRI GAGGAG 2 cut(s) 929, 1112
BseSI GKGCMC 2 cut(s) 59, 1182
BseXI GCAGC 3 cut(s) 18, 213, 1257
BseYI CCCAGC 1 cut(s) 1085
Bsh1236I CGCG 1 cut(s) 155
BshFI GGCC 2 cut(s) 632, 1287
BsiHKAI GWGCWC 2 cut(s) 59, 1182
BsiHKCI CYCGRG 1 cut(s) 854
BsiSI CCGG 4 cut(s) 105, 932, 1127, 1353
BslI CCNNNNNNNGG 3 cut(s) 105, 1149, 1352
BsmAI GTCTC 3 cut(s) 165, 193, 922
BsmI GAATGC 1 cut(s) 303
BsnI GGCC 2 cut(s) 632, 1287
Bso31I GGTCTC 2 cut(s) 193, 922
BsoBI CYCGRG 1 cut(s) 854
Bsp1286I GDGCHC 4 cut(s) 59, 111, 1182, 1353
Bsp143I GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
BspACI CCGC 5 cut(s) 155, 185, 564, 774, 878
BspANI GGCC 2 cut(s) 632, 1287
BspCNI CTCAG 1 cut(s) 1339
BspFNI CGCG 1 cut(s) 155
BspHI TCATGA 1 cut(s) 36
BspPI GGATC 2 cut(s) 376, 726
BspTNI GGTCTC 2 cut(s) 193, 922
BsrFI RCCGGY 1 cut(s) 1126
BsrI ACTGG 1 cut(s) 1288
BssAI RCCGGY 1 cut(s) 1126
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
Bst4CI ACNGT 6 cut(s) 406, 637, 739, 897, 1045, 1184
BstAPI GCANNNNNTGC 1 cut(s) 485
BstC8I GCNNGC 3 cut(s) 861, 1083, 1124
BstDEI CTNAG 1 cut(s) 1347
BstF5I GGATG 5 cut(s) 481, 606, 940, 987, 1064
BstFNI CGCG 1 cut(s) 155
BstH2I RGCGCY 1 cut(s) 584
BstHHI GCGC 4 cut(s) 6, 155, 583, 1373
BstKTI GATC 6 cut(s) 115, 371, 712, 721, 1240, 1378
BstMAI GTCTC 3 cut(s) 165, 193, 922
BstMBI GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
BstMWI GCNNNNNNNGC 6 cut(s) 210, 485, 570, 797, 865, 1368
BstNSI RCATGY 5 cut(s) 660, 763, 1126, 1173, 1273
BstSCI CCNGG 2 cut(s) 104, 1351
BstSLI GKGCMC 2 cut(s) 59, 1182
BstUI CGCG 1 cut(s) 155
BstV1I GCAGC 3 cut(s) 18, 213, 1257
BstV2I GAAGAC 1 cut(s) 263
BstX2I RGATCY 2 cut(s) 718, 1375
BstXI CCANNNNNNTGG 1 cut(s) 461
BstYI RGATCY 2 cut(s) 718, 1375
BsuRI GGCC 2 cut(s) 632, 1287
BtsCI GGATG 5 cut(s) 481, 606, 940, 987, 1064
BtsI GCAGTG 1 cut(s) 59
BtsIMutI CAGTG 4 cut(s) 59, 633, 1050, 1295
Cac8I GCNNGC 3 cut(s) 861, 1083, 1124
CciI TCATGA 1 cut(s) 36
CfoI GCGC 4 cut(s) 6, 155, 583, 1373
Cfr10I RCCGGY 1 cut(s) 1126
Cfr13I GGNCC 1 cut(s) 163
CseI GACGC 1 cut(s) 874
Csp6I GTAC 3 cut(s) 399, 695, 1327
CspCI CAANNNNNGTGG 2 cut(s) 622, 657
CviQI GTAC 3 cut(s) 399, 695, 1327
DdeI CTNAG 1 cut(s) 1347
DpnI GATC 6 cut(s) 114, 370, 711, 720, 1239, 1377
DpnII GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
DrdI GACNNNNNNGTC 2 cut(s) 185, 1162
DriI GACNNNNNGTC 1 cut(s) 870
DseDI GACNNNNNNGTC 2 cut(s) 185, 1162
Eam1105I GACNNNNNGTC 1 cut(s) 870
Eco24I GRGCYC 2 cut(s) 111, 1353
Eco31I GGTCTC 2 cut(s) 193, 922
Eco47I GGWCC 1 cut(s) 163
Eco47III AGCGCT 1 cut(s) 582
Eco57I CTGAAG 3 cut(s) 1218, 1428, 1440
Eco88I CYCGRG 1 cut(s) 854
EcoT22I ATGCAT 1 cut(s) 1064
EcoT38I GRGCYC 2 cut(s) 111, 1353
FauNDI CATATG 2 cut(s) 456, 1383
FbaI TGATCA 1 cut(s) 709
Fnu4HI GCNGC 4 cut(s) 7, 202, 1246, 1434
FokI GGATG 5 cut(s) 488, 613, 947, 994, 1071
FriOI GRGCYC 2 cut(s) 111, 1353
Fsp4HI GCNGC 4 cut(s) 7, 202, 1246, 1434
FspBI CTAG 3 cut(s) 513, 584, 1444
FspI TGCGCA 1 cut(s) 5
GlaI GCGC 4 cut(s) 5, 154, 582, 1372
GluI GCNGC 4 cut(s) 7, 202, 1246, 1434
GsaI CCCAGC 1 cut(s) 1089
HaeII RGCGCY 1 cut(s) 584
HaeIII GGCC 2 cut(s) 632, 1287
HapII CCGG 4 cut(s) 105, 932, 1127, 1353
HgaI GACGC 1 cut(s) 874
HhaI GCGC 4 cut(s) 6, 155, 583, 1373
Hin6I GCGC 4 cut(s) 4, 153, 581, 1371
HinP1I GCGC 4 cut(s) 4, 153, 581, 1371
HindIII AAGCTT 1 cut(s) 920
HinfI GANTC 5 cut(s) 422, 850, 1033, 1213, 1400
HpaII CCGG 4 cut(s) 105, 932, 1127, 1353
HphI GGTGA 2 cut(s) 1141, 1196
Hpy166II GTNNAC 3 cut(s) 57, 1180, 1441
Hpy188I TCNGA 6 cut(s) 163, 170, 373, 1032, 1237, 1420
Hpy188III TCNNGA 4 cut(s) 37, 595, 901, 1210
Hpy8I GTNNAC 3 cut(s) 57, 1180, 1441
Hpy99I CGWCG 1 cut(s) 868
HpyAV CCTTC 4 cut(s) 808, 986, 1198, 1308
HpyCH4III ACNGT 6 cut(s) 406, 637, 739, 897, 1045, 1184
HpyCH4IV ACGT 1 cut(s) 729
HpyCH4V TGCA 9 cut(s) 57, 301, 479, 573, 1062, 1180, 1277, 1324, 1433
HpyF10VI GCNNNNNNNGC 6 cut(s) 210, 485, 570, 797, 865, 1368
HpyF3I CTNAG 1 cut(s) 1347
HpySE526I ACGT 1 cut(s) 729
HspAI GCGC 4 cut(s) 4, 153, 581, 1371
Ksp22I TGATCA 1 cut(s) 709
Kzo9I GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
LmnI GCTCC 2 cut(s) 776, 1119
Lsp1109I GCAGC 3 cut(s) 18, 213, 1257
LweI GCATC 3 cut(s) 466, 787, 1049
MaeI CTAG 3 cut(s) 513, 584, 1444
MaeII ACGT 1 cut(s) 729
MaeIII GTNAC 3 cut(s) 643, 733, 940
MalI GATC 6 cut(s) 114, 370, 711, 720, 1239, 1377
MboI GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
MboII GAAGA 8 cut(s) 268, 797, 832, 835, 1008, 1011, 1370, 1433
MfeI CAATTG 1 cut(s) 362
MflI RGATCY 2 cut(s) 718, 1375
MhlI GDGCHC 4 cut(s) 59, 111, 1182, 1353
MluCI AATT 6 cut(s) 325, 362, 559, 745, 753, 1011
MlyI GAGTC 2 cut(s) 1222, 1394
MmeI TCCRAC 1 cut(s) 891
Mph1103I ATGCAT 1 cut(s) 1064
MseI TTAA 2 cut(s) 752, 804
MslI CAYNNNNRTG 4 cut(s) 62, 459, 873, 1127
MspI CCGG 4 cut(s) 105, 932, 1127, 1353
MspR9I CCNGG 2 cut(s) 106, 1353
MunI CAATTG 1 cut(s) 362
Mva1269I GAATGC 1 cut(s) 303
MvnI CGCG 1 cut(s) 155
MwoI GCNNNNNNNGC 6 cut(s) 210, 485, 570, 797, 865, 1368
NciI CCSGG 2 cut(s) 106, 1353
NdeI CATATG 2 cut(s) 456, 1383
NdeII GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
NmeAIII GCCGAG 2 cut(s) 111, 632
NmuCI GTSAC 2 cut(s) 643, 733
NsbI TGCGCA 1 cut(s) 5
NsiI ATGCAT 1 cut(s) 1064
NspI RCATGY 5 cut(s) 660, 763, 1126, 1173, 1273
PaeI GCATGC 1 cut(s) 1126
PagI TCATGA 1 cut(s) 36
PciI ACATGT 2 cut(s) 759, 1269
PcsI WCGNNNNNNNCGW 1 cut(s) 1188
PctI GAATGC 1 cut(s) 303
PfeI GAWTC 3 cut(s) 422, 850, 1033
PflFI GACNNNGTC 1 cut(s) 739
PflMI CCANNNNNTGG 1 cut(s) 1149
PkrI GCNGC 4 cut(s) 8, 203, 1247, 1435
PleI GAGTC 2 cut(s) 1221, 1394
PpsI GAGTC 2 cut(s) 1221, 1394
PscI ACATGT 2 cut(s) 759, 1269
Psp1406I AACGTT 1 cut(s) 729
PspFI CCCAGC 1 cut(s) 1085
PspPI GGNCC 1 cut(s) 163
PsuI RGATCY 2 cut(s) 718, 1375
PsyI GACNNNGTC 1 cut(s) 739
RsaI GTAC 3 cut(s) 400, 696, 1328
RsaNI GTAC 3 cut(s) 399, 695, 1327
RseI CAYNNNNRTG 4 cut(s) 62, 459, 873, 1127
SaqAI TTAA 2 cut(s) 752, 804
SatI GCNGC 4 cut(s) 7, 202, 1246, 1434
Sau3AI GATC 6 cut(s) 112, 368, 709, 718, 1237, 1375
Sau96I GGNCC 1 cut(s) 163
SchI GAGTC 2 cut(s) 1222, 1394
ScrFI CCNGG 2 cut(s) 106, 1353
SduI GDGCHC 4 cut(s) 59, 111, 1182, 1353
SfaNI GCATC 3 cut(s) 466, 787, 1049
SinI GGWCC 1 cut(s) 163
SmiMI CAYNNNNRTG 4 cut(s) 62, 459, 873, 1127
SmlI CTYRAG 3 cut(s) 347, 595, 923
SmoI CTYRAG 3 cut(s) 347, 595, 923
SphI GCATGC 1 cut(s) 1126
Sse9I AATT 6 cut(s) 325, 362, 559, 745, 753, 1011
SsiI CCGC 5 cut(s) 155, 185, 564, 774, 878
SspMI CTAG 3 cut(s) 513, 584, 1444
StyD4I CCNGG 2 cut(s) 104, 1351
TaaI ACNGT 6 cut(s) 406, 637, 739, 897, 1045, 1184
TaiI ACGT 1 cut(s) 732
TaqI TCGA 3 cut(s) 111, 501, 1191
TasI AATT 6 cut(s) 325, 362, 559, 745, 753, 1011
TatI WGTACW 2 cut(s) 398, 1326
TfiI GAWTC 3 cut(s) 422, 850, 1033
Tru1I TTAA 2 cut(s) 752, 804
Tru9I TTAA 2 cut(s) 752, 804
TscAI CASTG 4 cut(s) 59, 640, 1050, 1295
TseFI GTSAC 2 cut(s) 643, 733
TseI GCWGC 4 cut(s) 6, 201, 1245, 1433
Tsp45I GTSAC 2 cut(s) 643, 733
TspDTI ATGAA 6 cut(s) 80, 519, 827, 1005, 1370, 1400
TspGWI ACGGA 2 cut(s) 731, 1071
TspRI CASTG 4 cut(s) 59, 640, 1050, 1295
Tth111I GACNNNGTC 1 cut(s) 739
Van91I CCANNNNNTGG 1 cut(s) 1149
VneI GTGCAC 2 cut(s) 55, 1178
VpaK11BI GGWCC 1 cut(s) 163
XceI RCATGY 5 cut(s) 660, 763, 1126, 1173, 1273
XspI CTAG 3 cut(s) 513, 584, 1444
Zsp2I ATGCAT 1 cut(s) 1064
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.