Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001130.1

Orthogroup ID

OG0009264

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 12838

Gene Structure 12838 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001130.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 3993 bp

gtggtgggagagactgataccaaagtcagatggcactcggtgttagtcggtgggaagtgtaaccctgccaaatccacaactcaaataaacttgaaaaatggcctctatttcggcaaccggtatgagtccactgctgcagcctcggatgcaacagccgcaccacctgttgagaaatacgagtatcaagctgaggttagtcgccttatggacctcattgttaacagcttgtacagcaacaaggaggtgttccttcgagagcttgtcagcaatgcgagtgatgccttggacaagctccggtttcttagtgttacagaacctgaccttttgaagggtggaggtgagcttgatatccgtatccagactgatactgacaatggaatcataaatatcactgattctggcattggaatgactcgggaagagcttgtggattgtttgggaacaattgcacaaagtgggacttcaaagttcttgaaggcattaaaggatactaaagatgctggtggtgacagcaatttaattggtcagtttggtgttggcttttactccgcattcctggttgcagatcgggttgttgtctctacaaagtctccgaaatctgacaaacaatatgtatggcaaggagaggcaaatgctagctcttatacgattcaggaggagactgaccctgagaagattcttcctaggggaacccgcttgaccttgtatctgaagcgtgacgacaaaggttttgctcatccagaacgtattcagaagcttgtgaaaaactattcacagtttgtttcttttcctatatacacgtggcaggaaaagggatacactaaagaggttgaggttgatgaggatccagctgaatccaaaaaagatgagcaagatgacaagactgagaagaagaagaaaactaagacagttgttgagaaatactgggattgggatctcactaatgaaacacaaccaatatggcttcgcaatcctaaagaagtcactacagaggattacaatgagttctacaagaatacttttaatgaatacttggatccactggcttcttcacactttacaacagagggtgaagtagaattcaggtctgtattatatgtcccagctgttgctcctatgggaaaggatgacatgatcaatcccaagacaaaaaatataaggctttatgtgaaacgggtgttcatttcagatgactttgatggagaactgttcccacgatacttgagcttcatcaaaggtgttgtggattcaaatgatcttcccctcaacgtctcacgtgaaattcttcaggagagtcgcattgtgcggattatgaggaagcgtttagttcgaaaggcctttgacatgattctgggaatatccatgagtgaaaacagagaggattatgaaaagttctgggaaaattttggcaaacacttgaaactgggttgcattgaagatcgtgaaaatcataaacgtcttgccccattgcttagatttttctcttcccaaagtgaggatgttatgatcagcttggatgaatatgttgagaacatgaaacctgagcagaaggatatctatttcattgctgctgacagtgtgacaagcgcaagtaatacgccattcctggagaaacttcttcagaaggatcttgaagtactgtatttagttgatcctattgatgaggttgccattacaaacctaaaatcatacaaggaaaagaattttgttgatattagcaaggaagatctgaatttaggggataagaatgaggaaaaagaaaaggagattaagcaggagtttggccaaacatgtgattggatcaagaagcgtttgggtgataaagttgccagtgttcagatttcaaaccgtcttagtacatcaccctgcgttcttgtatctgggaagttcggttggtctgccaacatggagaggttgatgaaggcacaaactgttggggatacttctagcttagagtacatgagaggcagaagggtctttgagattaatcctgagcacccaatcattcaaaacttgaatgctgcaagtagagttaatccagacgatgcagatgcaatgagagctattgatcttttgtatgatgcagctttggtttctagcggttttactcctgagaatccagcagagctgggtggaaagatttatgagatgatggggttggctctttcggggaaatggtctgcacctgttgccgaggtccaggaggttcagcatcaagaagccgcaccacagcacaacagcacggagacattagatggtgaggtggttgagccagatactaaagatgctggtggtgacagcaatttaattggtcagtttggtgttggcttttactccgcattcctggttgcagatcgggttgttgtctctacaaagtctccgaaatctgacaaacagtatgtatggcaaggagaggcaaatgctagctcttatacgattcaggaggagactgaccctgagaagattctccctaggggaacccgcttgaccttgtatctgaagcgtgacgacaaaggttttgctcatccagaacgtattcagaagcttgtgaaaaactattcacagtttgtttcttttcctatatacacgtggcaggaaaagggatacactaaagaggttgaggttgatgaggatccagctgaatccaaaaaagatgagcaagataacaagactgagaagaagaagaaaactaagacagttgttgagaaatactgggattgggatctcactaatgaaacacaaccaatatggcttcgcaatcctaaagaagtcactacagaggattacaatgagttctacaagaatacttttaatgaatacttggatccactggcttcttcacactttacaacagagggtgaagtagaattcaggtctgtattatatgtcccagctgttgctcctatgggaaaggatgacatgatcaatcccaagacaaaaaatataaggctttatgtgaaacgggtgttcatttcagatgactttgatggagaactggtgcggattatgaggaagcgtttagttcgaaaggcctttgacatgattctgggaatatccatgagtgaaaacagagaggattatgaaaagttctgggaaaattttggcaaacacttgaaactgggttgcattgaagatcgtgaaaatcataaacgtcttgccccattgcttagatttttctcttcccaaagtgaggatgttatgatcagcttggatgaatatgttgagaacatgaaacctgagcagaaggatatctatttcattgctgctgacagtgtgacaagcgcaagtaatacgccattcctggagaaacttcttcagaaggatcttgaagtactgtatttagttgatcctattgatgaggttgccattacaaacctaaaatcatacaaggaaaagaattttgttgatattagcaaggaagatctgaatttaggggataagaatgaggaaaaagaaaaggagattaagcaggagtttggccaaacatgtgattggatcaagaagcgtttgggtgataaagttgccagtgttcagatttcaaaccgtcttagtacatcaccctgcgttcttgtatctgggaagttcggttggtctgccaacatggagaggttgatgaaggcacaaactgttggggatacttctagcttagagtacatgagaggcagaagggtctttgagattaatcctgagcacccaatcattcaaaacttgaatgctgcaagtagagttaatccagacgatgcagatgcaatgagagctattgatcttttgtatgatgcagctttggtttctagcggttttactcctgagaatccagcagagctgggtggaaagatttatgagatgatggggttggctctttcggggaaatggtctgcacctgttgccgaggtccaggaggttcagcatcaagaagccgcaccacagcacaacagcacggagacattagatggtgaggtggttgagccagtccaagctggtagccaaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0005488 GO:0005524 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0008144 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0017076 GO:0030312 GO:0030554 GO:0032553 GO:0032555 GO:0032559 GO:0035639 GO:0036094 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0071944 GO:0097159 GO:0097367 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko04141 ko04151 ko04626 ko04657 ko04915 ko04918 ko05200 ko05215 ko05418 map04141 map04151 map04626 map04657 map04915 map04918 map05200 map05215 map05418

Pfam Domains

Protein Families

HATPase_c HSP90

Protein Analysis

1330

Amino Acids

151.33

Weight (kDa)

5.04

Isoelectric Point (pI)

33.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009264)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07770 AT3G07770 AT3G07770
fragaria_vesca	FvH4_6g41100 FvH4_6g41100
malus_domestica	MD09G1122200.v1.1 MD17G1113200.v1.1
prunus_persica	Prupe.3G201400_v2.0.a1
pyrus_communis	pycom09g04650 pycom17g10480
rosa_chinensis	RchiOBHm_Chr2g0156661
rosa_laevigata	RLG00000020929
rosa_multiflora	Rmu_sc0001130.1_g000001 Rmu_sc0018228.1_g000001
rosa_roxburghii	Rroxscaffold_2G00092860
rosa_rugosa	Rorug02G0455200
rosa_samantha	Rh2AG520800 Rh2BG534000 Rh2CG505800 Rh2DG542800
rosa_wichuraiana	Rw0G013720 Rw2G042970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	2 cut(s)	1783, 3478
AcsI	RAATTY	9 cut(s)	1079, 1281, 1402, 1702, 1732, 2867, 3097, 3397, 3427
AcuI	CTGAAG	5 cut(s)	731, 1271, 1604, 2519, 3299
AcvI	CACGTG	3 cut(s)	801, 1277, 2589
AdeI	CACNNNGTG	2 cut(s)	40, 455
AfaI	GTAC	7 cut(s)	230, 1638, 1858, 1958, 3333, 3553, 3653
AfiI	CCNNNNNNNGG	3 cut(s)	328, 1495, 3190
AflIII	ACRYGT	4 cut(s)	798, 1790, 2586, 3485
AgeI	ACCGGT	1 cut(s)	117
AjnI	CCWGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
Alw21I	GWGCWC	2 cut(s)	1998, 3693
AlwNI	CAGNNNCTG	1 cut(s)	317
Ama87I	CYCGRG	1 cut(s)	414
AoxI	GGCC	5 cut(s)	100, 1335, 1783, 3030, 3478
ApeKI	GCWGC	8 cut(s)	134, 137, 1568, 2021, 2084, 3263, 3716, 3779
ApoI	RAATTY	9 cut(s)	1079, 1281, 1402, 1702, 1732, 2867, 3097, 3397, 3427
ArsI	GACNNNNNNTTYG	4 cut(s)	713, 745, 2501, 2533
AseI	ATTAAT	2 cut(s)	1986, 3681
AsiGI	ACCGGT	1 cut(s)	117
Asp700I	GAANNNNTTC	3 cut(s)	747, 1284, 2535
AspA2I	CCTAGG	2 cut(s)	683, 2471
AspLEI	GCGC	2 cut(s)	1589, 3284
AspS9I	GGNCC	3 cut(s)	208, 2197, 3892
AsuII	TTCGAA	2 cut(s)	1330, 3025
AsuNHI	GCTAGC	2 cut(s)	635, 2423
AvaI	CYCGRG	1 cut(s)	414
AvaII	GGWCC	3 cut(s)	208, 2197, 3892
AvrII	CCTAGG	2 cut(s)	683, 2471
BaeI	ACNNNNGTAYC	2 cut(s)	9, 42
BalI	TGGCCA	2 cut(s)	1785, 3480
BamHI	GGATCC	4 cut(s)	844, 1036, 2632, 2824
BbrPI	CACGTG	3 cut(s)	801, 1277, 2589
Bbv12I	GWGCWC	2 cut(s)	1998, 3693
BbvCI	CCTCAGC	1 cut(s)	189
BbvI	GCAGC	8 cut(s)	121, 149, 1555, 2008, 2096, 3250, 3703, 3791
BccI	CCATC	7 cut(s)	24, 1193, 2146, 2249, 2981, 3841, 3944
BcgI	CGANNNNNNTGC	4 cut(s)	2033, 2067, 3728, 3762
BciT130I	CCWGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
BciVI	GTATCC	6 cut(s)	365, 481, 809, 1933, 2597, 3628
BclI	TGATCA	4 cut(s)	1134, 1506, 2922, 3201
BfaI	CTAG	8 cut(s)	636, 684, 1947, 2097, 2424, 2472, 3642, 3792
BfmI	CTRYAG	3 cut(s)	135, 987, 2775
BfuI	GTATCC	6 cut(s)	365, 481, 809, 1933, 2597, 3628
BglII	AGATCT	2 cut(s)	1726, 3421
BlnI	CCTAGG	2 cut(s)	683, 2471
BmcAI	AGTACT	2 cut(s)	1638, 3333
Bme1390I	CCNGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
Bme18I	GGWCC	3 cut(s)	208, 2197, 3892
BmeT110I	CYCGRG	1 cut(s)	414
BmgT120I	GGNCC	3 cut(s)	208, 2197, 3892
BmiI	GGNNCC	6 cut(s)	691, 846, 1038, 2479, 2634, 2826
BmrFI	CCNGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
BmrI	ACTGGG	4 cut(s)	934, 1433, 2722, 3128
BmtI	GCTAGC	2 cut(s)	639, 2427
BmuI	ACTGGG	4 cut(s)	934, 1433, 2722, 3128
BpmI	CTGGAG	2 cut(s)	1628, 3323
Bpu10I	CCTNAGC	5 cut(s)	189, 1542, 1992, 3237, 3687
Bpu14I	TTCGAA	2 cut(s)	1330, 3025
BpuEI	CTTGAG	1 cut(s)	1243
BsaAI	YACGTR	3 cut(s)	801, 1277, 2589
BsaBI	GATNNNNATC	4 cut(s)	843, 933, 2631, 2721
BsaJI	CCNNGG	6 cut(s)	141, 282, 683, 2193, 2471, 3888
BsaWI	WCCGGW	2 cut(s)	117, 294
BsaXI	ACNNNNNCTCC	6 cut(s)	574, 604, 2362, 2392, 2982, 3012
Bsc4I	CCNNNNNNNGG	3 cut(s)	328, 1495, 3190
Bse118I	RCCGGY	1 cut(s)	117
Bse3DI	GCAATG	7 cut(s)	274, 1466, 1563, 2061, 3161, 3258, 3756
Bse8I	GATNNNNATC	4 cut(s)	843, 933, 2631, 2721
BseBI	CCWGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
BseDI	CCNNGG	6 cut(s)	141, 282, 683, 2193, 2471, 3888
BseGI	GGATG	9 cut(s)	151, 736, 1132, 1504, 1522, 2524, 2920, 3199, 3217
BseJI	GATNNNNATC	4 cut(s)	843, 933, 2631, 2721
BseLI	CCNNNNNNNGG	3 cut(s)	328, 1495, 3190
BseMI	GCAATG	7 cut(s)	274, 1466, 1563, 2061, 3161, 3258, 3756
BseRI	GAGGAG	2 cut(s)	671, 2459
BseXI	GCAGC	8 cut(s)	121, 149, 1555, 2008, 2096, 3250, 3703, 3791
BseYI	CCCAGC	4 cut(s)	1102, 2128, 2890, 3823
BsgI	GTGCAG	2 cut(s)	2166, 3861
BshFI	GGCC	5 cut(s)	102, 1337, 1785, 3032, 3480
BshTI	ACCGGT	1 cut(s)	117
BsiHKAI	GWGCWC	2 cut(s)	1998, 3693
BsiHKCI	CYCGRG	1 cut(s)	414
BsiSI	CCGG	2 cut(s)	118, 295
BslFI	GGGAC	3 cut(s)	472, 1085, 2873
BslI	CCNNNNNNNGG	3 cut(s)	328, 1495, 3190
BsmBI	CGTCTC	1 cut(s)	1276
BsmFI	GGGAC	3 cut(s)	472, 1085, 2873
BsmI	GAATGC	4 cut(s)	551, 2023, 2339, 3718
BsnI	GGCC	5 cut(s)	102, 1337, 1785, 3032, 3480
BsoBI	CYCGRG	1 cut(s)	414
Bsp119I	TTCGAA	2 cut(s)	1330, 3025
Bsp1286I	GDGCHC	2 cut(s)	1998, 3693
Bsp1407I	TGTACA	1 cut(s)	228
BspANI	GGCC	5 cut(s)	102, 1337, 1785, 3032, 3480
BspLI	GGNNCC	6 cut(s)	691, 846, 1038, 2479, 2634, 2826
BspMAI	CTGCAG	1 cut(s)	139
BspOI	GCTAGC	2 cut(s)	639, 2427
BspQI	GCTCTTC	1 cut(s)	414
BspT104I	TTCGAA	2 cut(s)	1330, 3025
BsrDI	GCAATG	7 cut(s)	274, 1466, 1563, 2061, 3161, 3258, 3756
BsrFI	RCCGGY	1 cut(s)	117
BsrGI	TGTACA	1 cut(s)	228
BssAI	RCCGGY	1 cut(s)	117
BssECI	CCNNGG	6 cut(s)	141, 282, 683, 2193, 2471, 3888
BssT1I	CCWWGG	3 cut(s)	282, 683, 2471
Bst2UI	CCWGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
Bst6I	CTCTTC	3 cut(s)	414, 1489, 3184
BstAPI	GCANNNNNTGC	2 cut(s)	2189, 3884
BstAUI	TGTACA	1 cut(s)	228
BstBAI	YACGTR	3 cut(s)	801, 1277, 2589
BstBI	TTCGAA	2 cut(s)	1330, 3025
BstC8I	GCNNGC	2 cut(s)	637, 2425
BstENI	CCTNNNNNAGG	1 cut(s)	326
BstF5I	GGATG	9 cut(s)	151, 736, 1132, 1504, 1522, 2524, 2920, 3199, 3217
BstHHI	GCGC	2 cut(s)	1589, 3284
BstMWI	GCNNNNNNNGC	8 cut(s)	146, 155, 231, 278, 2060, 2189, 3755, 3884
BstNI	CCWGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
BstNSI	RCATGY	2 cut(s)	1794, 3489
BstSCI	CCNGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
BstSFI	CTRYAG	3 cut(s)	135, 987, 2775
BstV1I	GCAGC	8 cut(s)	121, 149, 1555, 2008, 2096, 3250, 3703, 3791
BsuI	GTATCC	6 cut(s)	365, 481, 809, 1933, 2597, 3628
BsuRI	GGCC	5 cut(s)	102, 1337, 1785, 3032, 3480
BtsCI	GGATG	9 cut(s)	151, 736, 1132, 1504, 1522, 2524, 2920, 3199, 3217
BtsI	GCAGTG	1 cut(s)	129
BtsIMutI	CAGTG	8 cut(s)	129, 390, 1040, 1582, 1837, 2828, 3277, 3532
Cac8I	GCNNGC	2 cut(s)	637, 2425
CaiI	CAGNNNCTG	1 cut(s)	317
CfoI	GCGC	2 cut(s)	1589, 3284
Cfr10I	RCCGGY	1 cut(s)	117
Cfr13I	GGNCC	3 cut(s)	208, 2197, 3892
Csp6I	GTAC	7 cut(s)	229, 1637, 1857, 1957, 3332, 3552, 3652
CspAI	ACCGGT	1 cut(s)	117
CspCI	CAANNNNNGTGG	2 cut(s)	1203, 1238
CviQI	GTAC	7 cut(s)	229, 1637, 1857, 1957, 3332, 3552, 3652
DraIII	CACNNNGTG	2 cut(s)	40, 455
EaeI	YGGCCR	2 cut(s)	1783, 3478
Eam1104I	CTCTTC	3 cut(s)	414, 1489, 3184
EarI	CTCTTC	3 cut(s)	414, 1489, 3184
Eco130I	CCWWGG	3 cut(s)	282, 683, 2471
Eco147I	AGGCCT	2 cut(s)	1337, 3032
Eco32I	GATATC	3 cut(s)	349, 1555, 3250
Eco47I	GGWCC	3 cut(s)	208, 2197, 3892
Eco57I	CTGAAG	5 cut(s)	731, 1271, 1604, 2519, 3299
Eco72I	CACGTG	3 cut(s)	801, 1277, 2589
Eco88I	CYCGRG	1 cut(s)	414
EcoNI	CCTNNNNNAGG	1 cut(s)	326
EcoRI	GAATTC	2 cut(s)	1079, 2867
EcoRII	CCWGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
EcoRV	GATATC	3 cut(s)	349, 1555, 3250
EcoT14I	CCWWGG	3 cut(s)	282, 683, 2471
ErhI	CCWWGG	3 cut(s)	282, 683, 2471
Esp3I	CGTCTC	1 cut(s)	1276
FalI	AAGNNNNNCTT	2 cut(s)	445, 477
FaqI	GGGAC	3 cut(s)	472, 1085, 2873
FauI	CCCGC	2 cut(s)	701, 2489
FbaI	TGATCA	4 cut(s)	1134, 1506, 2922, 3201
FokI	GGATG	9 cut(s)	158, 723, 1139, 1511, 1529, 2511, 2927, 3206, 3224
FspBI	CTAG	8 cut(s)	636, 684, 1947, 2097, 2424, 2472, 3642, 3792
GlaI	GCGC	2 cut(s)	1588, 3283
GsaI	CCCAGC	4 cut(s)	1106, 2132, 2894, 3827
GsuI	CTGGAG	2 cut(s)	1628, 3323
HaeIII	GGCC	5 cut(s)	102, 1337, 1785, 3032, 3480
HapII	CCGG	2 cut(s)	118, 295
HhaI	GCGC	2 cut(s)	1589, 3284
Hin6I	GCGC	2 cut(s)	1587, 3282
HinP1I	GCGC	2 cut(s)	1587, 3282
HincII	GTYRAC	1 cut(s)	220
HindII	GTYRAC	1 cut(s)	220
HindIII	AAGCTT	2 cut(s)	755, 2543
HpaI	GTTAAC	1 cut(s)	220
HpaII	CCGG	2 cut(s)	118, 295
Hpy166II	GTNNAC	2 cut(s)	129, 220
Hpy8I	GTNNAC	2 cut(s)	129, 220
HpyCH4IV	ACGT	8 cut(s)	745, 800, 1269, 1276, 1456, 2533, 2588, 3151
HpyF10VI	GCNNNNNNNGC	8 cut(s)	146, 155, 231, 278, 2060, 2189, 3755, 3884
HpySE526I	ACGT	8 cut(s)	745, 800, 1269, 1276, 1456, 2533, 2588, 3151
HspAI	GCGC	2 cut(s)	1587, 3282
Ksp22I	TGATCA	4 cut(s)	1134, 1506, 2922, 3201
KspAI	GTTAAC	1 cut(s)	220
LguI	GCTCTTC	1 cut(s)	414
LmnI	GCTCC	3 cut(s)	297, 1117, 2905
Lsp1109I	GCAGC	8 cut(s)	121, 149, 1555, 2008, 2096, 3250, 3703, 3791
MaeI	CTAG	8 cut(s)	636, 684, 1947, 2097, 2424, 2472, 3642, 3792
MaeII	ACGT	8 cut(s)	745, 800, 1269, 1276, 1456, 2533, 2588, 3151
MfeI	CAATTG	1 cut(s)	444
MhlI	GDGCHC	2 cut(s)	1998, 3693
MlsI	TGGCCA	2 cut(s)	1785, 3480
MluNI	TGGCCA	2 cut(s)	1785, 3480
MlyI	GAGTC	3 cut(s)	134, 406, 1303
Mox20I	TGGCCA	2 cut(s)	1785, 3480
MroXI	GAANNNNTTC	3 cut(s)	747, 1284, 2535
MscI	TGGCCA	2 cut(s)	1785, 3480
MslI	CAYNNNNRTG	1 cut(s)	407
Msp20I	TGGCCA	2 cut(s)	1785, 3480
MspA1I	CMGCKG	4 cut(s)	851, 1106, 2639, 2894
MspI	CCGG	2 cut(s)	118, 295
MspR9I	CCNGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
MunI	CAATTG	1 cut(s)	444
Mva1269I	GAATGC	4 cut(s)	551, 2023, 2339, 3718
MvaI	CCWGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
MwoI	GCNNNNNNNGC	8 cut(s)	146, 155, 231, 278, 2060, 2189, 3755, 3884
NheI	GCTAGC	2 cut(s)	635, 2423
NlaIV	GGNNCC	6 cut(s)	691, 846, 1038, 2479, 2634, 2826
NmeAIII	GCCGAG	2 cut(s)	2218, 3913
NmuCI	GTSAC	8 cut(s)	506, 716, 982, 1579, 2294, 2504, 2770, 3274
NspI	RCATGY	2 cut(s)	1794, 3489
NspV	TTCGAA	2 cut(s)	1330, 3025
PceI	AGGCCT	2 cut(s)	1337, 3032
PciI	ACATGT	2 cut(s)	1790, 3485
PciSI	GCTCTTC	1 cut(s)	414
PctI	GAATGC	4 cut(s)	551, 2023, 2339, 3718
PdmI	GAANNNNTTC	3 cut(s)	747, 1284, 2535
PfoI	TCCNGGA	4 cut(s)	1605, 2199, 3300, 3894
PinAI	ACCGGT	1 cut(s)	117
PleI	GAGTC	3 cut(s)	133, 406, 1302
PmaCI	CACGTG	3 cut(s)	801, 1277, 2589
PmlI	CACGTG	3 cut(s)	801, 1277, 2589
PpsI	GAGTC	3 cut(s)	133, 406, 1302
Ppu21I	YACGTR	3 cut(s)	801, 1277, 2589
PscI	ACATGT	2 cut(s)	1790, 3485
PshBI	ATTAAT	2 cut(s)	1986, 3681
Psp6I	CCWGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
PspCI	CACGTG	3 cut(s)	801, 1277, 2589
PspFI	CCCAGC	4 cut(s)	1102, 2128, 2890, 3823
PspGI	CCWGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
PspN4I	GGNNCC	6 cut(s)	691, 846, 1038, 2479, 2634, 2826
PspPI	GGNCC	3 cut(s)	208, 2197, 3892
PstI	CTGCAG	1 cut(s)	139
PstNI	CAGNNNCTG	1 cut(s)	317
PvuII	CAGCTG	4 cut(s)	851, 1106, 2639, 2894
RsaI	GTAC	7 cut(s)	230, 1638, 1858, 1958, 3333, 3553, 3653
RsaNI	GTAC	7 cut(s)	229, 1637, 1857, 1957, 3332, 3552, 3652
RseI	CAYNNNNRTG	1 cut(s)	407
SapI	GCTCTTC	1 cut(s)	414
Sau96I	GGNCC	3 cut(s)	208, 2197, 3892
ScaI	AGTACT	2 cut(s)	1638, 3333
SchI	GAGTC	3 cut(s)	134, 406, 1303
ScrFI	CCNGG	6 cut(s)	557, 1607, 2201, 2345, 3302, 3896
SduI	GDGCHC	2 cut(s)	1998, 3693
SfcI	CTRYAG	3 cut(s)	135, 987, 2775
SfuI	TTCGAA	2 cut(s)	1330, 3025
SinI	GGWCC	3 cut(s)	208, 2197, 3892
SmiMI	CAYNNNNRTG	1 cut(s)	407
SmlI	CTYRAG	1 cut(s)	1222
SmoI	CTYRAG	1 cut(s)	1222
SseBI	AGGCCT	2 cut(s)	1337, 3032
SspMI	CTAG	8 cut(s)	636, 684, 1947, 2097, 2424, 2472, 3642, 3792
StuI	AGGCCT	2 cut(s)	1337, 3032
StyD4I	CCNGG	6 cut(s)	555, 1605, 2199, 2343, 3300, 3894
StyI	CCWWGG	3 cut(s)	282, 683, 2471
TaiI	ACGT	8 cut(s)	748, 803, 1272, 1279, 1459, 2536, 2591, 3154
TaqI	TCGA	3 cut(s)	253, 1330, 3025
TatI	WGTACW	7 cut(s)	228, 1636, 1856, 1956, 3331, 3551, 3651
TauI	GCSGC	3 cut(s)	158, 2225, 3920
TscAI	CASTG	8 cut(s)	136, 397, 1047, 1582, 1837, 2835, 3277, 3532
TseFI	GTSAC	8 cut(s)	506, 716, 982, 1579, 2294, 2504, 2770, 3274
TseI	GCWGC	8 cut(s)	134, 137, 1568, 2021, 2084, 3263, 3716, 3779
Tsp45I	GTSAC	8 cut(s)	506, 716, 982, 1579, 2294, 2504, 2770, 3274
TspGWI	ACGGA	3 cut(s)	341, 2258, 3953
TspRI	CASTG	8 cut(s)	136, 397, 1047, 1582, 1837, 2835, 3277, 3532
VpaK11BI	GGWCC	3 cut(s)	208, 2197, 3892
VspI	ATTAAT	2 cut(s)	1986, 3681
XagI	CCTNNNNNAGG	1 cut(s)	326
XapI	RAATTY	9 cut(s)	1079, 1281, 1402, 1702, 1732, 2867, 3097, 3397, 3427
XceI	RCATGY	2 cut(s)	1794, 3489
XmaJI	CCTAGG	2 cut(s)	683, 2471
XmnI	GAANNNNTTC	3 cut(s)	747, 1284, 2535
XspI	CTAG	8 cut(s)	636, 684, 1947, 2097, 2424, 2472, 3642, 3792
ZrmI	AGTACT	2 cut(s)	1638, 3333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.