Rmu_sc0001198.1_g000015

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001198.1
Physical Location & Seq
Forward (+)
73273 .. 73770
498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001198.1_g000015.1.cds

Sequence Viewer

Length: 498 bp
atgttgagagaaggtattcaaccaactcatggaacttttgttgggattctattagcttgcgctcatgctggattagtggatgagggattggaatatttcgaaagcatggaaaaggttcatggactaatgccggagatgaaacactacgggtgcattgtggatattttgagccgttctggtaaagtgaaggaggcatatgagttcatgaagaatatgcctatcgttccagatgttgtagtatggagaattttgctgggtgcttgtcaagttcatggaaatttggccttggctgagattgtgtcaaacaagcttattgaattggacccttctaacagtgggaactatattctctcatcaaataactatgcactttcacatagatgggatggcgttgcaaaaatgagaggattgatggacgagagtaacgtgcagaagccatttggtagtagctccattgaaattaatggtgcattgtcaaatcacttatctaatacatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

165

Amino Acids

18.13

Weight (kDa)

5.76

Isoelectric Point (pI)

43.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 29
AcsI RAATTY 2 cut(s) 246, 277
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 3 cut(s) 20, 317, 458
AluBI AGCT 3 cut(s) 56, 310, 450
AluI AGCT 3 cut(s) 56, 310, 450
AoxI GGCC 1 cut(s) 282
ApoI RAATTY 2 cut(s) 246, 277
AseI ATTAAT 1 cut(s) 462
Asp700I GAANNNNTTC 2 cut(s) 15, 114
AspLEI GCGC 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 322
AsuII TTCGAA 1 cut(s) 99
AvaII GGWCC 1 cut(s) 322
BccI CCATC 3 cut(s) 375, 380, 406
BceAI ACGGC 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 322
BmgT120I GGNCC 1 cut(s) 322
BmiI GGNNCC 1 cut(s) 324
Bpu14I TTCGAA 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 285
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 285
BseGI GGATG 2 cut(s) 85, 391
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 282
BseYI CCCAGC 1 cut(s) 253
BsgI GTGCAG 1 cut(s) 449
BshFI GGCC 1 cut(s) 284
BsiSI CCGG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 29
BsnI GGCC 1 cut(s) 284
Bsp119I TTCGAA 1 cut(s) 99
BspANI GGCC 1 cut(s) 284
BspCNI CTCAG 1 cut(s) 283
BspHI TCATGA 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 324
BspT104I TTCGAA 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 285
BssT1I CCWWGG 1 cut(s) 285
Bst4CI ACNGT 1 cut(s) 335
BstBI TTCGAA 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 291
BstF5I GGATG 2 cut(s) 85, 391
BstHHI GCGC 1 cut(s) 62
BsuRI GGCC 1 cut(s) 284
BtsCI GGATG 2 cut(s) 85, 391
BtsIMutI CAGTG 1 cut(s) 340
Cac8I GCNNGC 1 cut(s) 58
CciI TCATGA 1 cut(s) 204
CfoI GCGC 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 322
CviAII CATG 6 cut(s) 29, 65, 106, 119, 205, 272
CviJI RGCY 7 cut(s) 56, 171, 284, 290, 310, 436, 450
CviKI_1 RGCY 7 cut(s) 56, 171, 284, 290, 310, 436, 450
DdeI CTNAG 1 cut(s) 291
Eco130I CCWWGG 1 cut(s) 285
Eco47I GGWCC 1 cut(s) 322
EcoT14I CCWWGG 1 cut(s) 285
ErhI CCWWGG 1 cut(s) 285
FaeI CATG 6 cut(s) 32, 68, 109, 122, 208, 275
FatI CATG 6 cut(s) 28, 64, 105, 118, 204, 271
FauNDI CATATG 1 cut(s) 196
FokI GGATG 2 cut(s) 92, 398
GlaI GCGC 1 cut(s) 61
GsaI CCCAGC 1 cut(s) 257
HaeIII GGCC 1 cut(s) 284
HapII CCGG 1 cut(s) 131
HhaI GCGC 1 cut(s) 62
Hin1II CATG 6 cut(s) 32, 68, 109, 122, 208, 275
Hin6I GCGC 1 cut(s) 60
HinP1I GCGC 1 cut(s) 60
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 1 cut(s) 46
HpaII CCGG 1 cut(s) 131
Hpy188III TCNNGA 2 cut(s) 205, 227
HpyAV CCTTC 3 cut(s) 5, 181, 336
HpyCH4III ACNGT 1 cut(s) 335
HpyCH4IV ACGT 1 cut(s) 426
HpyCH4V TGCA 5 cut(s) 153, 368, 395, 430, 470
HpyF3I CTNAG 1 cut(s) 291
HpySE526I ACGT 1 cut(s) 426
Hsp92II CATG 6 cut(s) 32, 68, 109, 122, 208, 275
HspAI GCGC 1 cut(s) 60
LmnI GCTCC 1 cut(s) 455
LpnPI CCDG 5 cut(s) 54, 144, 162, 239, 240
MaeII ACGT 1 cut(s) 426
MaeIII GTNAC 1 cut(s) 422
MboII GAAGA 1 cut(s) 220
MluCI AATT 4 cut(s) 246, 277, 317, 459
MnlI CCTC 3 cut(s) 76, 184, 398
MroXI GAANNNNTTC 2 cut(s) 15, 114
MseI TTAA 1 cut(s) 462
MslI CAYNNNNRTG 1 cut(s) 379
MspI CCGG 1 cut(s) 131
NdeI CATATG 1 cut(s) 196
NlaIII CATG 6 cut(s) 32, 68, 109, 122, 208, 275
NlaIV GGNNCC 1 cut(s) 324
NspV TTCGAA 1 cut(s) 99
PagI TCATGA 1 cut(s) 204
PcsI WCGNNNNNNNCGW 1 cut(s) 423
PdmI GAANNNNTTC 2 cut(s) 15, 114
PfeI GAWTC 1 cut(s) 46
PflMI CCANNNNNTGG 1 cut(s) 29
PshBI ATTAAT 1 cut(s) 462
PspFI CCCAGC 1 cut(s) 253
PspN4I GGNNCC 1 cut(s) 324
PspPI GGNCC 1 cut(s) 322
RseI CAYNNNNRTG 1 cut(s) 379
SaqAI TTAA 1 cut(s) 462
Sau96I GGNCC 1 cut(s) 322
SetI ASST 6 cut(s) 16, 58, 117, 312, 429, 452
SfuI TTCGAA 1 cut(s) 99
SinI GGWCC 1 cut(s) 322
SmiMI CAYNNNNRTG 1 cut(s) 379
Sse9I AATT 4 cut(s) 246, 277, 317, 459
SspI AATATT 1 cut(s) 95
StyI CCWWGG 1 cut(s) 285
TaaI ACNGT 1 cut(s) 335
TaiI ACGT 1 cut(s) 429
TaqI TCGA 1 cut(s) 99
TasI AATT 4 cut(s) 246, 277, 317, 459
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 1 cut(s) 462
Tru9I TTAA 1 cut(s) 462
TscAI CASTG 1 cut(s) 340
TspDTI ATGAA 5 cut(s) 107, 152, 193, 221, 260
TspRI CASTG 1 cut(s) 340
Van91I CCANNNNNTGG 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 322
VspI ATTAAT 1 cut(s) 462
XapI RAATTY 2 cut(s) 246, 277
XmnI GAANNNNTTC 2 cut(s) 15, 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.