Rmu_sc0001200.1_g000040

Ammonium transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001200.1
OG0016977
Physical Location & Seq
Forward (+)
215026 .. 223544
8519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001200.1_g000040.1.cds

Sequence Viewer

Length: 816 bp
atgtttgcggccataacaccgatactgttggcagggtcggtgctagggagaatgaacttcaaggcgtggatgatgttcatgcctctgtggctgaccttctcgtacaccgtcggtgcgtttagcatgtggggcggagggtttttatttcactggggagttatggactacgctggcgggtacttcattcatctttcttcagggactgctggtttcatcactgcttactgggtggccggacaacggcaaaatgaaggggagaaggagcgtgatggcggcaaaacgaaggggagaaggagagaggccaatgcgggggaagagagagaaactccggggggggagggtgagaaagagaaggtagagcctgaaattgttgttgtgaatgaagaaaagaaaacaggagaatatgagaagaagggtaaggtacttgcatctgaggattctcggcaacattggaatggtttcaagcctgggcatttccaacgcaatacttctgacatagtatccgcctttcagaagacctgcattttggaagaagacctgcatctgtctggattggtgtccttgatggacctggaattggtgaaaaagggttttgatgattatgcccggaaaaggaagaagtggctgtttgtaatggctgctttgggcttctctggttatggtgcttatagggtttatcactcgccttcagtatgtcaaaaaagaaagaggcttttgaaccttttaggtgctttagtttctgtagttgaagtggtttcagactctgctgagtcgattggaattgtgtctaaagatttgaaggagtctgcaatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ammonium_transp

Protein Analysis

271

Amino Acids

30.24

Weight (kDa)

8.67

Isoelectric Point (pI)

31.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 527, 546
AciI CCGC 6 cut(s) 8, 132, 174, 273, 308, 504
AcoI YGGCCR 2 cut(s) 9, 231
AcuI CTGAAG 2 cut(s) 180, 672
AfaI GTAC 3 cut(s) 104, 179, 423
AfiI CCNNNNNNNGG 4 cut(s) 240, 309, 577, 612
AgsI TTSAA 5 cut(s) 61, 463, 718, 749, 799
AjnI CCWGG 2 cut(s) 466, 570
AlwNI CAGNNNCTG 2 cut(s) 203, 764
AoxI GGCC 3 cut(s) 9, 231, 300
ApeKI GCWGC 1 cut(s) 638
ArsI GACNNNNNNTTYG 2 cut(s) 508, 540
Asp700I GAANNNNTTC 1 cut(s) 458
AspS9I GGNCC 1 cut(s) 568
AsuC2I CCSGG 2 cut(s) 330, 607
AsuHPI GGTGA 2 cut(s) 353, 592
AvaII GGWCC 1 cut(s) 568
BbsI GAAGAC 2 cut(s) 521, 540
BbvI GCAGC 1 cut(s) 625
BccI CCATC 2 cut(s) 263, 559
BceAI ACGGC 1 cut(s) 257
BciT130I CCWGG 2 cut(s) 468, 572
BciVI GTATCC 1 cut(s) 511
BcnI CCSGG 2 cut(s) 330, 607
BfaI CTAG 1 cut(s) 44
BfmI CTRYAG 1 cut(s) 741
BfuAI ACCTGC 2 cut(s) 527, 546
BfuI GTATCC 1 cut(s) 511
BglI GCCNNNNNGGC 1 cut(s) 88
BisI GCNGC 3 cut(s) 9, 274, 639
BlsI GCNGC 3 cut(s) 10, 275, 640
Bme1390I CCNGG 4 cut(s) 330, 468, 572, 607
Bme18I GGWCC 1 cut(s) 568
BmgT120I GGNCC 1 cut(s) 568
BmrFI CCNGG 4 cut(s) 330, 468, 572, 607
BmrI ACTGGG 2 cut(s) 160, 235
BmsI GCATC 2 cut(s) 437, 550
BmuI ACTGGG 2 cut(s) 160, 235
BpiI GAAGAC 2 cut(s) 521, 540
BplI GAGNNNNNCTC 2 cut(s) 310, 342
BpuMI CCSGG 2 cut(s) 330, 607
BsaJI CCNNGG 2 cut(s) 329, 467
Bsc4I CCNNNNNNNGG 4 cut(s) 240, 309, 577, 612
Bse1I ACTGG 2 cut(s) 155, 230
BseBI CCWGG 2 cut(s) 468, 572
BseDI CCNNGG 2 cut(s) 329, 467
BseGI GGATG 1 cut(s) 75
BseLI CCNNNNNNNGG 4 cut(s) 240, 309, 577, 612
BseMII CTCAG 2 cut(s) 423, 759
BseNI ACTGG 2 cut(s) 155, 230
BseXI GCAGC 1 cut(s) 625
BshFI GGCC 3 cut(s) 11, 233, 302
BsiSI CCGG 3 cut(s) 234, 329, 607
BslFI GGGAC 1 cut(s) 214
BslI CCNNNNNNNGG 4 cut(s) 240, 309, 577, 612
BsmFI GGGAC 1 cut(s) 214
BsnI GGCC 3 cut(s) 11, 233, 302
BspACI CCGC 6 cut(s) 8, 132, 174, 273, 308, 504
BspANI GGCC 3 cut(s) 11, 233, 302
BspCNI CTCAG 2 cut(s) 424, 760
BspMI ACCTGC 2 cut(s) 527, 546
BsrI ACTGG 2 cut(s) 155, 230
BssECI CCNNGG 2 cut(s) 329, 467
Bst2UI CCWGG 2 cut(s) 468, 572
Bst4CI ACNGT 2 cut(s) 27, 109
Bst6I CTCTTC 1 cut(s) 309
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 2 cut(s) 432, 768
BstF5I GGATG 1 cut(s) 75
BstMWI GCNNNNNNNGC 2 cut(s) 88, 129
BstNI CCWGG 2 cut(s) 468, 572
BstNSI RCATGY 1 cut(s) 127
BstSCI CCNGG 4 cut(s) 328, 466, 570, 605
BstSFI CTRYAG 1 cut(s) 741
BstV1I GCAGC 1 cut(s) 625
BstV2I GAAGAC 2 cut(s) 521, 540
BsuI GTATCC 1 cut(s) 511
BsuRI GGCC 3 cut(s) 11, 233, 302
BtsCI GGATG 1 cut(s) 75
BtsI GCAGTG 1 cut(s) 216
BtsIMutI CAGTG 2 cut(s) 148, 216
BveI ACCTGC 2 cut(s) 527, 546
Cac8I GCNNGC 1 cut(s) 172
CaiI CAGNNNCTG 2 cut(s) 203, 764
Cfr13I GGNCC 1 cut(s) 568
Csp6I GTAC 3 cut(s) 103, 178, 422
CviAII CATG 2 cut(s) 79, 124
CviQI GTAC 3 cut(s) 103, 178, 422
DdeI CTNAG 2 cut(s) 432, 768
EaeI YGGCCR 2 cut(s) 9, 231
Eam1104I CTCTTC 1 cut(s) 309
EarI CTCTTC 1 cut(s) 309
EciI GGCGGA 2 cut(s) 147, 493
Eco47I GGWCC 1 cut(s) 568
Eco57I CTGAAG 2 cut(s) 180, 672
EcoRII CCWGG 2 cut(s) 466, 570
FaeI CATG 2 cut(s) 82, 127
FaqI GGGAC 1 cut(s) 214
FatI CATG 2 cut(s) 78, 123
FauI CCCGC 2 cut(s) 167, 301
Fnu4HI GCNGC 3 cut(s) 9, 274, 639
FokI GGATG 1 cut(s) 82
Fsp4HI GCNGC 3 cut(s) 9, 274, 639
FspBI CTAG 1 cut(s) 44
GluI GCNGC 3 cut(s) 9, 274, 639
HaeIII GGCC 3 cut(s) 11, 233, 302
HapII CCGG 3 cut(s) 234, 329, 607
Hin1II CATG 2 cut(s) 82, 127
HinfI GANTC 4 cut(s) 437, 761, 770, 803
HpaII CCGG 3 cut(s) 234, 329, 607
HphI GGTGA 2 cut(s) 353, 592
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 4 cut(s) 433, 493, 513, 760
Hpy188III TCNNGA 1 cut(s) 549
Hpy8I GTNNAC 1 cut(s) 105
Hpy99I CGWCG 1 cut(s) 113
HpyAV CCTTC 9 cut(s) 106, 245, 253, 277, 285, 346, 406, 696, 793
HpyCH4III ACNGT 2 cut(s) 27, 109
HpyCH4V TGCA 4 cut(s) 428, 522, 541, 809
HpyF10VI GCNNNNNNNGC 2 cut(s) 88, 129
HpyF3I CTNAG 2 cut(s) 432, 768
Hsp92II CATG 2 cut(s) 82, 127
LmnI GCTCC 1 cut(s) 262
Lsp1109I GCAGC 1 cut(s) 625
LweI GCATC 2 cut(s) 437, 550
MaeI CTAG 1 cut(s) 44
MboII GAAGA 8 cut(s) 186, 326, 395, 421, 526, 542, 545, 628
MluCI AATT 4 cut(s) 366, 575, 780, 810
MlyI GAGTC 3 cut(s) 755, 779, 812
MmeI TCCRAC 1 cut(s) 502
MnlI CCTC 6 cut(s) 93, 128, 292, 331, 427, 702
MroXI GAANNNNTTC 1 cut(s) 458
MslI CAYNNNNRTG 1 cut(s) 453
MspI CCGG 3 cut(s) 234, 329, 607
MspR9I CCNGG 4 cut(s) 330, 468, 572, 607
MvaI CCWGG 2 cut(s) 468, 572
MwoI GCNNNNNNNGC 2 cut(s) 88, 129
NciI CCSGG 2 cut(s) 330, 607
NlaIII CATG 2 cut(s) 82, 127
NmeAIII GCCGAG 1 cut(s) 421
NspI RCATGY 1 cut(s) 127
PdmI GAANNNNTTC 1 cut(s) 458
PfeI GAWTC 1 cut(s) 437
PkrI GCNGC 3 cut(s) 10, 275, 640
PleI GAGTC 3 cut(s) 755, 778, 811
PpsI GAGTC 3 cut(s) 755, 778, 811
Psp6I CCWGG 2 cut(s) 466, 570
PspGI CCWGG 2 cut(s) 466, 570
PspPI GGNCC 1 cut(s) 568
PstNI CAGNNNCTG 2 cut(s) 203, 764
RsaI GTAC 3 cut(s) 104, 179, 423
RsaNI GTAC 3 cut(s) 103, 178, 422
RseI CAYNNNNRTG 1 cut(s) 453
SatI GCNGC 3 cut(s) 9, 274, 639
Sau96I GGNCC 1 cut(s) 568
SchI GAGTC 3 cut(s) 755, 779, 812
ScrFI CCNGG 4 cut(s) 330, 468, 572, 607
SetI ASST 8 cut(s) 98, 357, 423, 521, 540, 573, 723, 730
SfaNI GCATC 2 cut(s) 437, 550
SfcI CTRYAG 1 cut(s) 741
SinI GGWCC 1 cut(s) 568
SmiMI CAYNNNNRTG 1 cut(s) 453
Sse9I AATT 4 cut(s) 366, 575, 780, 810
SsiI CCGC 6 cut(s) 8, 132, 174, 273, 308, 504
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 4 cut(s) 328, 466, 570, 605
TaaI ACNGT 2 cut(s) 27, 109
TaqI TCGA 1 cut(s) 773
TasI AATT 4 cut(s) 366, 575, 780, 810
TauI GCSGC 2 cut(s) 11, 276
TfiI GAWTC 1 cut(s) 437
TscAI CASTG 2 cut(s) 155, 223
TseI GCWGC 1 cut(s) 638
TspDTI ATGAA 7 cut(s) 67, 68, 172, 176, 202, 264, 396
TspRI CASTG 2 cut(s) 155, 223
VpaK11BI GGWCC 1 cut(s) 568
XceI RCATGY 1 cut(s) 127
XmnI GAANNNNTTC 1 cut(s) 458
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.