Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001502.1

Orthogroup ID

OG0014957

Physical Location & Seq

Genomic Coordinates Forward (+)

47306 .. 50268

Gene Structure 2963 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001502.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atgatttcaggtctcttttcagaatttacaccagaattgatatcgtccagaggtttggcaaccagtcctccattggaggtgaacaattgtgagagatttgcaatgtctcaaagacagagcaacctaagagaattcacatgtgcggagctgaaagcagcaacaaagaattttagtctctccctcatgcttggagagggtgggtttggtggtgtgtataggggtatcatcaggtgtgcacaagatccacataagaagatagatgtcgctgttaaacaactgagtaaaaggggattgcagggccacaaagagtgggtgactgaagttaatgttttagggattgttgagcatcaaaatcttgtcaaattactgggctactgcgctgaggatgatgaaagagggatccagaggctcctgatatatgaatatatgcccaacaggagtgtacaagatcacttaacaagccggtttcagattgcactcccttgggtcacaagggtcaaaatagcacaggatgctgctcgaggattagcatacctccatgaagaaatggaatttcagattatcttcagggatttcaagtcttcaaacatacttttggatgaacattggaatgcaaagttatccgactttggattagcacggctggggccttcagacggagtgagccacgtctctactgccgttgttggaacagttggatatgcagctcctgaatacattcaaacaggacatctcacgtcgaaaagtgatgtgtggagttacggcattttcctttttgaactcatcacaggaaggcggcctgtggaccgaaaccgccccaagaatgagcaaaagctcttggaatgggtgagagcacatctgtctgcagattcaaaaaagtttcagcttattatggatccaaggctcgaagggaagtattccctcaaggctgcacaaaagctagcagctgtggccaaccggtgcttggttagacagccgagatcacgtcctaaaatgagtgaagtactggagatgataaatagaattgtggagacgacaacagatatgggaagccctcaaaaactcccttcagagagtttagagcactccaaagatgaatttttgacagaatccaaaagggagattttgagaaggaagtttgtggatccacttattggagagaatggttgcttgaatttgcaaatatggagacccaagatattgaagacatgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

404

Amino Acids

45.84

Weight (kDa)

9.03

Isoelectric Point (pI)

39.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014957)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39110 AT2G39110
fragaria_vesca	FvH4_7g18950
malus_domestica	MD01G1105200.v1.1
prunus_persica	Prupe.2G210500_v2.0.a1 Prupe.2G210500_v2.0.a1
pyrus_communis	pycom01g13170 pycom07g16590
rosa_chinensis	RchiOBHm_Chr1g0362881
rosa_laevigata	RLG00000027615
rosa_multiflora	Rmu_sc0001502.1_g000012
rosa_roxburghii	Rroxscaffold_4G00293680
rosa_rugosa	Rorug01G0302100 Rorug01G0302100
rosa_samantha	Rh1BG274200
rosa_wichuraiana	Rw1G027580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	1154
AciI	CCGC	3 cut(s)	143, 796, 814
AclWI	GGATC	7 cut(s)	236, 394, 407, 890, 903, 1139, 1152
AcoI	YGGCCR	1 cut(s)	951
AcsI	RAATTY	6 cut(s)	23, 131, 166, 551, 1097, 1174
AcuI	CTGAAG	4 cut(s)	339, 550, 636, 1053
AfaI	GTAC	2 cut(s)	444, 1005
AfiI	CCNNNNNNNGG	3 cut(s)	656, 964, 1154
AflIII	ACRYGT	2 cut(s)	137, 1208
AgeI	ACCGGT	1 cut(s)	957
AgsI	TTSAA	7 cut(s)	577, 585, 722, 779, 873, 1174, 1204
AjiI	CACGTC	3 cut(s)	670, 738, 986
AluBI	AGCT	6 cut(s)	148, 707, 835, 886, 940, 947
AluI	AGCT	6 cut(s)	148, 707, 835, 886, 940, 947
Alw21I	GWGCWC	3 cut(s)	238, 856, 1086
Alw26I	GTCTC	6 cut(s)	17, 111, 179, 676, 1025, 1183
Alw44I	GTGCAC	1 cut(s)	234
AlwI	GGATC	7 cut(s)	236, 394, 407, 890, 903, 1139, 1152
AlwNI	CAGNNNCTG	1 cut(s)	710
Ama87I	CYCGRG	1 cut(s)	519
AoxI	GGCC	4 cut(s)	298, 647, 797, 951
ApaLI	GTGCAC	1 cut(s)	234
ApeKI	GCWGC	5 cut(s)	155, 515, 704, 929, 944
ApoI	RAATTY	6 cut(s)	23, 131, 166, 551, 1097, 1174
AsiGI	ACCGGT	1 cut(s)	957
Asp700I	GAANNNNTTC	1 cut(s)	717
AspLEI	GCGC	1 cut(s)	380
AspS9I	GGNCC	3 cut(s)	298, 647, 805
AsuHPI	GGTGA	3 cut(s)	91, 325, 859
AsuNHI	GCTAGC	1 cut(s)	940
AvaI	CYCGRG	1 cut(s)	519
AvaII	GGWCC	1 cut(s)	805
BaeGI	GKGCMC	1 cut(s)	238
BalI	TGGCCA	1 cut(s)	953
BamHI	GGATCC	3 cut(s)	399, 895, 1144
BbsI	GAAGAC	2 cut(s)	573, 1211
Bbv12I	GWGCWC	3 cut(s)	238, 856, 1086
BbvCI	CCTCAGC	1 cut(s)	381
BbvI	GCAGC	5 cut(s)	167, 502, 716, 916, 956
BceAI	ACGGC	3 cut(s)	656, 665, 778
BcoDI	GTCTC	6 cut(s)	17, 111, 179, 676, 1025, 1183
BfaI	CTAG	1 cut(s)	941
BfmI	CTRYAG	1 cut(s)	864
BisI	GCNGC	6 cut(s)	156, 516, 705, 797, 930, 945
BlsI	GCNGC	6 cut(s)	157, 517, 706, 798, 931, 946
BmcAI	AGTACT	1 cut(s)	1005
Bme18I	GGWCC	1 cut(s)	805
BmeT110I	CYCGRG	1 cut(s)	519
BmgBI	CACGTC	3 cut(s)	670, 738, 986
BmgT120I	GGNCC	3 cut(s)	298, 647, 805
BmiI	GGNNCC	5 cut(s)	401, 410, 648, 897, 1146
BmrI	ACTGGG	1 cut(s)	377
BmsI	GCATC	2 cut(s)	355, 502
BmtI	GCTAGC	1 cut(s)	944
BmuI	ACTGGG	1 cut(s)	377
BpiI	GAAGAC	2 cut(s)	573, 1211
BpmI	CTGGAG	1 cut(s)	1028
Bpu10I	CCTNAGC	1 cut(s)	381
BpuEI	CTTGAG	1 cut(s)	908
BsaI	GGTCTC	2 cut(s)	17, 1183
BsaJI	CCNNGG	2 cut(s)	482, 899
BsaWI	WCCGGW	1 cut(s)	957
BsaXI	ACNNNNNCTCC	2 cut(s)	52, 82
Bsc4I	CCNNNNNNNGG	3 cut(s)	656, 964, 1154
Bse118I	RCCGGY	2 cut(s)	462, 957
Bse1I	ACTGG	3 cut(s)	63, 372, 1011
Bse3DI	GCAATG	1 cut(s)	108
BseDI	CCNNGG	2 cut(s)	482, 899
BseGI	GGATG	3 cut(s)	391, 517, 604
BseLI	CCNNNNNNNGG	3 cut(s)	656, 964, 1154
BseMI	GCAATG	1 cut(s)	108
BseMII	CTCAG	2 cut(s)	269, 372
BseNI	ACTGG	3 cut(s)	63, 372, 1011
BseSI	GKGCMC	1 cut(s)	238
BseXI	GCAGC	5 cut(s)	167, 502, 716, 916, 956
BseYI	CCCAGC	1 cut(s)	643
BsgI	GTGCAG	1 cut(s)	915
BshFI	GGCC	4 cut(s)	300, 649, 799, 953
BshTI	ACCGGT	1 cut(s)	957
BsiHKAI	GWGCWC	3 cut(s)	238, 856, 1086
BsiHKCI	CYCGRG	1 cut(s)	519
BsiSI	CCGG	2 cut(s)	463, 958
BslI	CCNNNNNNNGG	3 cut(s)	656, 964, 1154
BsmAI	GTCTC	6 cut(s)	17, 111, 179, 676, 1025, 1183
BsmBI	CGTCTC	2 cut(s)	676, 1025
BsmI	GAATGC	1 cut(s)	616
BsnI	GGCC	4 cut(s)	300, 649, 799, 953
Bso31I	GGTCTC	2 cut(s)	17, 1183
BsoBI	CYCGRG	1 cut(s)	519
Bsp1286I	GDGCHC	3 cut(s)	238, 856, 1086
Bsp1407I	TGTACA	1 cut(s)	442
Bsp143I	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
BspACI	CCGC	3 cut(s)	143, 796, 814
BspANI	GGCC	4 cut(s)	300, 649, 799, 953
BspCNI	CTCAG	2 cut(s)	270, 373
BspLI	GGNNCC	5 cut(s)	401, 410, 648, 897, 1146
BspMAI	CTGCAG	1 cut(s)	868
BspOI	GCTAGC	1 cut(s)	944
BspPI	GGATC	7 cut(s)	236, 394, 407, 890, 903, 1139, 1152
BspTNI	GGTCTC	2 cut(s)	17, 1183
BsrDI	GCAATG	1 cut(s)	108
BsrFI	RCCGGY	2 cut(s)	462, 957
BsrGI	TGTACA	1 cut(s)	442
BsrI	ACTGG	3 cut(s)	63, 372, 1011
BssAI	RCCGGY	2 cut(s)	462, 957
BssECI	CCNNGG	2 cut(s)	482, 899
BssMI	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
BssT1I	CCWWGG	2 cut(s)	482, 899
Bst4CI	ACNGT	1 cut(s)	694
BstAPI	GCANNNNNTGC	1 cut(s)	512
BstAUI	TGTACA	1 cut(s)	442
BstC8I	GCNNGC	1 cut(s)	942
BstDEI	CTNAG	3 cut(s)	125, 278, 381
BstF5I	GGATG	3 cut(s)	391, 517, 604
BstHHI	GCGC	1 cut(s)	380
BstKTI	GATC	6 cut(s)	244, 402, 451, 898, 983, 1147
BstMAI	GTCTC	6 cut(s)	17, 111, 179, 676, 1025, 1183
BstMBI	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
BstMWI	GCNNNNNNNGC	2 cut(s)	512, 950
BstNSI	RCATGY	2 cut(s)	141, 1212
BstSFI	CTRYAG	1 cut(s)	864
BstSLI	GKGCMC	1 cut(s)	238
BstV1I	GCAGC	5 cut(s)	167, 502, 716, 916, 956
BstV2I	GAAGAC	2 cut(s)	573, 1211
BstX2I	RGATCY	4 cut(s)	241, 399, 895, 1144
BstXI	CCANNNNNNTGG	1 cut(s)	55
BstYI	RGATCY	4 cut(s)	241, 399, 895, 1144
BsuRI	GGCC	4 cut(s)	300, 649, 799, 953
BtrI	CACGTC	3 cut(s)	670, 738, 986
BtsCI	GGATG	3 cut(s)	391, 517, 604
Cac8I	GCNNGC	1 cut(s)	942
CaiI	CAGNNNCTG	1 cut(s)	710
CfoI	GCGC	1 cut(s)	380
Cfr10I	RCCGGY	2 cut(s)	462, 957
Cfr13I	GGNCC	3 cut(s)	298, 647, 805
Csp6I	GTAC	2 cut(s)	443, 1004
CspAI	ACCGGT	1 cut(s)	957
CviAII	CATG	4 cut(s)	138, 184, 539, 1209
CviQI	GTAC	2 cut(s)	443, 1004
DdeI	CTNAG	3 cut(s)	125, 278, 381
DpnI	GATC	6 cut(s)	243, 401, 450, 897, 982, 1146
DpnII	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
EaeI	YGGCCR	1 cut(s)	951
Eco130I	CCWWGG	2 cut(s)	482, 899
Eco31I	GGTCTC	2 cut(s)	17, 1183
Eco32I	GATATC	1 cut(s)	42
Eco47I	GGWCC	1 cut(s)	805
Eco57I	CTGAAG	4 cut(s)	339, 550, 636, 1053
Eco88I	CYCGRG	1 cut(s)	519
EcoO109I	RGGNCCY	1 cut(s)	647
EcoRI	GAATTC	1 cut(s)	131
EcoRV	GATATC	1 cut(s)	42
EcoT14I	CCWWGG	2 cut(s)	482, 899
ErhI	CCWWGG	2 cut(s)	482, 899
Esp3I	CGTCTC	2 cut(s)	676, 1025
FaeI	CATG	4 cut(s)	141, 187, 542, 1212
FatI	CATG	4 cut(s)	137, 183, 538, 1208
Fnu4HI	GCNGC	6 cut(s)	156, 516, 705, 797, 930, 945
FokI	GGATG	3 cut(s)	398, 524, 611
Fsp4HI	GCNGC	6 cut(s)	156, 516, 705, 797, 930, 945
FspBI	CTAG	1 cut(s)	941
GlaI	GCGC	1 cut(s)	379
GluI	GCNGC	6 cut(s)	156, 516, 705, 797, 930, 945
GsaI	CCCAGC	1 cut(s)	647
GsuI	CTGGAG	1 cut(s)	1028
HaeIII	GGCC	4 cut(s)	300, 649, 799, 953
HapII	CCGG	2 cut(s)	463, 958
HhaI	GCGC	1 cut(s)	380
Hin1II	CATG	4 cut(s)	141, 187, 542, 1212
Hin6I	GCGC	1 cut(s)	378
HinP1I	GCGC	1 cut(s)	378
HinfI	GANTC	2 cut(s)	869, 1109
HpaII	CCGG	2 cut(s)	463, 958
HphI	GGTGA	3 cut(s)	91, 325, 859
Hpy166II	GTNNAC	4 cut(s)	82, 236, 443, 805
Hpy188I	TCNGA	6 cut(s)	22, 471, 558, 625, 655, 1072
Hpy188III	TCNNGA	4 cut(s)	48, 403, 412, 710
Hpy8I	GTNNAC	4 cut(s)	82, 236, 443, 805
Hpy99I	CGWCG	1 cut(s)	742
HpyAV	CCTTC	5 cut(s)	660, 786, 902, 1077, 1125
HpyCH4III	ACNGT	1 cut(s)	694
HpyCH4IV	ACGT	3 cut(s)	669, 737, 985
HpyCH4V	TGCA	9 cut(s)	101, 236, 295, 476, 614, 704, 866, 932, 1180
HpyF10VI	GCNNNNNNNGC	2 cut(s)	512, 950
HpyF3I	CTNAG	3 cut(s)	125, 278, 381
HpySE526I	ACGT	3 cut(s)	669, 737, 985
Hsp92II	CATG	4 cut(s)	141, 187, 542, 1212
HspAI	GCGC	1 cut(s)	378
Kzo9I	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
LmnI	GCTCC	3 cut(s)	145, 414, 712
Lsp1109I	GCAGC	5 cut(s)	167, 502, 716, 916, 956
LweI	GCATC	2 cut(s)	355, 502
MaeI	CTAG	1 cut(s)	941
MaeII	ACGT	3 cut(s)	669, 737, 985
MaeIII	GTNAC	3 cut(s)	313, 487, 758
MalI	GATC	6 cut(s)	243, 401, 450, 897, 982, 1146
MboI	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
MboII	GAAGA	4 cut(s)	265, 554, 556, 573
MfeI	CAATTG	1 cut(s)	85
MflI	RGATCY	4 cut(s)	241, 399, 895, 1144
MhlI	GDGCHC	3 cut(s)	238, 856, 1086
MlsI	TGGCCA	1 cut(s)	953
MluNI	TGGCCA	1 cut(s)	953
MmeI	TCCRAC	3 cut(s)	648, 667, 676
Mox20I	TGGCCA	1 cut(s)	953
MroXI	GAANNNNTTC	1 cut(s)	717
MscI	TGGCCA	1 cut(s)	953
MseI	TTAA	3 cut(s)	270, 324, 455
MslI	CAYNNNNRTG	1 cut(s)	609
Msp20I	TGGCCA	1 cut(s)	953
MspA1I	CMGCKG	1 cut(s)	947
MspI	CCGG	2 cut(s)	463, 958
MunI	CAATTG	1 cut(s)	85
Mva1269I	GAATGC	1 cut(s)	616
MwoI	GCNNNNNNNGC	2 cut(s)	512, 950
NdeII	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
NheI	GCTAGC	1 cut(s)	940
NlaIII	CATG	4 cut(s)	141, 187, 542, 1212
NlaIV	GGNNCC	5 cut(s)	401, 410, 648, 897, 1146
NmeAIII	GCCGAG	1 cut(s)	1002
NmuCI	GTSAC	2 cut(s)	313, 487
NspI	RCATGY	2 cut(s)	141, 1212
PaeR7I	CTCGAG	1 cut(s)	519
PciI	ACATGT	2 cut(s)	137, 1208
PctI	GAATGC	1 cut(s)	616
PdmI	GAANNNNTTC	1 cut(s)	717
PfeI	GAWTC	2 cut(s)	869, 1109
PflMI	CCANNNNNTGG	1 cut(s)	1154
PinAI	ACCGGT	1 cut(s)	957
PkrI	GCNGC	6 cut(s)	157, 517, 706, 798, 931, 946
PscI	ACATGT	2 cut(s)	137, 1208
PspFI	CCCAGC	1 cut(s)	643
PspN4I	GGNNCC	5 cut(s)	401, 410, 648, 897, 1146
PspPI	GGNCC	3 cut(s)	298, 647, 805
PspXI	VCTCGAGB	1 cut(s)	519
PstI	CTGCAG	1 cut(s)	868
PstNI	CAGNNNCTG	1 cut(s)	710
PsuI	RGATCY	4 cut(s)	241, 399, 895, 1144
PvuII	CAGCTG	1 cut(s)	947
RsaI	GTAC	2 cut(s)	444, 1005
RsaNI	GTAC	2 cut(s)	443, 1004
RseI	CAYNNNNRTG	1 cut(s)	609
SaqAI	TTAA	3 cut(s)	270, 324, 455
SatI	GCNGC	6 cut(s)	156, 516, 705, 797, 930, 945
Sau3AI	GATC	6 cut(s)	241, 399, 448, 895, 980, 1144
Sau96I	GGNCC	3 cut(s)	298, 647, 805
ScaI	AGTACT	1 cut(s)	1005
SduI	GDGCHC	3 cut(s)	238, 856, 1086
SfaNI	GCATC	2 cut(s)	355, 502
SfcI	CTRYAG	1 cut(s)	864
Sfr274I	CTCGAG	1 cut(s)	519
SinI	GGWCC	1 cut(s)	805
SlaI	CTCGAG	1 cut(s)	519
SmiMI	CAYNNNNRTG	1 cut(s)	609
SmlI	CTYRAG	2 cut(s)	519, 923
SmoI	CTYRAG	2 cut(s)	519, 923
SsiI	CCGC	3 cut(s)	143, 796, 814
SspMI	CTAG	1 cut(s)	941
StyI	CCWWGG	2 cut(s)	482, 899
TaaI	ACNGT	1 cut(s)	694
TaiI	ACGT	3 cut(s)	672, 740, 988
TaqI	TCGA	3 cut(s)	520, 740, 906
TaqII	GACCGA	1 cut(s)	822
TatI	WGTACW	2 cut(s)	442, 1003
TauI	GCSGC	1 cut(s)	799
TfiI	GAWTC	2 cut(s)	869, 1109
Tru1I	TTAA	3 cut(s)	270, 324, 455
Tru9I	TTAA	3 cut(s)	270, 324, 455
TseFI	GTSAC	2 cut(s)	313, 487
TseI	GCWGC	5 cut(s)	155, 515, 704, 929, 944
Tsp45I	GTSAC	2 cut(s)	313, 487
TspDTI	ATGAA	5 cut(s)	405, 435, 555, 615, 1110
TspGWI	ACGGA	1 cut(s)	672
Van91I	CCANNNNNTGG	1 cut(s)	1154
VneI	GTGCAC	1 cut(s)	234
VpaK11BI	GGWCC	1 cut(s)	805
XapI	RAATTY	6 cut(s)	23, 131, 166, 551, 1097, 1174
XceI	RCATGY	2 cut(s)	141, 1212
XcmI	CCANNNNNNNNNTGG	2 cut(s)	70, 961
XhoI	CTCGAG	1 cut(s)	519
XmnI	GAANNNNTTC	1 cut(s)	717
XspI	CTAG	1 cut(s)	941
ZrmI	AGTACT	1 cut(s)	1005

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.